Incidental Mutation 'R6364:Grin2d'
ID 513410
Institutional Source Beutler Lab
Gene Symbol Grin2d
Ensembl Gene ENSMUSG00000002771
Gene Name glutamate receptor, ionotropic, NMDA2D (epsilon 4)
Synonyms NR2D, GluRepsilon4, NMDAR2D, GluN2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45831883-45878378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45858454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 396 (E396G)
Ref Sequence ENSEMBL: ENSMUSP00000147663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000211713]
AlphaFold Q03391
Predicted Effect possibly damaging
Transcript: ENSMUST00000002848
AA Change: E396G

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771
AA Change: E396G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211713
AA Change: E396G

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced spontaneous activity and an elevated auditory brainstem response threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Grin2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Grin2d APN 7 45853292 missense probably damaging 0.99
IGL01772:Grin2d APN 7 45858466 missense probably benign 0.00
IGL01952:Grin2d APN 7 45862280 missense probably benign 0.23
IGL01994:Grin2d APN 7 45857972 missense probably damaging 1.00
IGL02161:Grin2d APN 7 45854422 missense possibly damaging 0.82
IGL03180:Grin2d APN 7 45853329 missense probably damaging 1.00
R1121:Grin2d UTSW 7 45854347 missense probably damaging 1.00
R1934:Grin2d UTSW 7 45856827 missense probably damaging 1.00
R2915:Grin2d UTSW 7 45833357 unclassified probably benign
R4162:Grin2d UTSW 7 45857618 missense probably damaging 0.98
R4753:Grin2d UTSW 7 45833906 missense probably damaging 0.98
R4781:Grin2d UTSW 7 45862481 missense probably damaging 1.00
R4785:Grin2d UTSW 7 45856781 missense probably damaging 0.96
R4820:Grin2d UTSW 7 45857939 missense probably damaging 1.00
R4877:Grin2d UTSW 7 45854615 missense probably damaging 1.00
R4979:Grin2d UTSW 7 45857933 missense probably benign 0.03
R5092:Grin2d UTSW 7 45854268 missense probably damaging 1.00
R6565:Grin2d UTSW 7 45834755 missense probably damaging 1.00
R6747:Grin2d UTSW 7 45862268 missense probably damaging 0.99
R6816:Grin2d UTSW 7 45833682 unclassified probably benign
R7072:Grin2d UTSW 7 45857498 missense probably damaging 1.00
R7237:Grin2d UTSW 7 45866176 nonsense probably null
R7243:Grin2d UTSW 7 45866128 missense probably damaging 1.00
R7385:Grin2d UTSW 7 45857536 missense probably damaging 1.00
R7577:Grin2d UTSW 7 45862379 missense probably benign 0.01
R8100:Grin2d UTSW 7 45833747 missense unknown
R8179:Grin2d UTSW 7 45858028 nonsense probably null
R8877:Grin2d UTSW 7 45854275 missense probably damaging 1.00
R8988:Grin2d UTSW 7 45834001 nonsense probably null
R9179:Grin2d UTSW 7 45856752 missense probably damaging 1.00
Z1177:Grin2d UTSW 7 45833177 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACCAGAACCTGTGCCTTC -3'
(R):5'- GTTCTGGCAACTAAGGGGAG -3'

Sequencing Primer
(F):5'- AGAACCTGTGCCTTCAGTTATGAC -3'
(R):5'- TGGCTTTCTGGTAAACCC -3'
Posted On 2018-04-27