Incidental Mutation 'R6364:Rnf141'
ID 513414
Institutional Source Beutler Lab
Gene Symbol Rnf141
Ensembl Gene ENSMUSG00000030788
Gene Name ring finger protein 141
Synonyms 2610110L04Rik, ZFP36, ZNF230
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R6364 (G1)
Quality Score 220.009
Status Validated
Chromosome 7
Chromosomal Location 110800432-110844457 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110821309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000134781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106682] [ENSMUST00000175981] [ENSMUST00000176746] [ENSMUST00000177236] [ENSMUST00000177462]
AlphaFold Q99MB7
Predicted Effect possibly damaging
Transcript: ENSMUST00000106682
AA Change: A163T

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788
AA Change: A163T

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175648
Predicted Effect probably benign
Transcript: ENSMUST00000175981
AA Change: A66T

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788
AA Change: A66T

DomainStartEndE-ValueType
RING 58 94 3.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176048
Predicted Effect unknown
Transcript: ENSMUST00000176210
AA Change: A10T
Predicted Effect probably benign
Transcript: ENSMUST00000176746
Predicted Effect possibly damaging
Transcript: ENSMUST00000177236
AA Change: A163T

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788
AA Change: A163T

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177462
AA Change: A163T

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788
AA Change: A163T

DomainStartEndE-ValueType
PDB:2ECN|A 144 180 3e-21 PDB
SCOP:d1fbva4 146 180 3e-7 SMART
Blast:RING 155 180 6e-12 BLAST
Meta Mutation Damage Score 0.1274 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Rnf141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rnf141 APN 7 110833734 unclassified probably benign
IGL02246:Rnf141 APN 7 110825287 missense probably benign
IGL02336:Rnf141 APN 7 110837198 nonsense probably null
R0482:Rnf141 UTSW 7 110837138 nonsense probably null
R1324:Rnf141 UTSW 7 110816843 nonsense probably null
R1718:Rnf141 UTSW 7 110821273 missense probably damaging 1.00
R2067:Rnf141 UTSW 7 110821365 splice site probably benign
R4151:Rnf141 UTSW 7 110837199 missense probably benign 0.19
R4867:Rnf141 UTSW 7 110816768 missense probably damaging 1.00
R4869:Rnf141 UTSW 7 110825350 missense probably damaging 1.00
R4947:Rnf141 UTSW 7 110825320 missense possibly damaging 0.66
R5320:Rnf141 UTSW 7 110833803 missense probably damaging 1.00
R8219:Rnf141 UTSW 7 110837265 start gained probably benign
R8492:Rnf141 UTSW 7 110837200 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTCAAAGCCCTGCTGCATC -3'
(R):5'- TTGCTCTGCACATTAGTCATTGTG -3'

Sequencing Primer
(F):5'- ACACTTCACTGAGCTAGGGG -3'
(R):5'- AGTCATTGTGTGATTTATACTGTGG -3'
Posted On 2018-04-27