Incidental Mutation 'R6364:Fam129c'
ID 513418
Institutional Source Beutler Lab
Gene Symbol Fam129c
Ensembl Gene ENSMUSG00000043243
Gene Name family with sequence similarity 129, member C
Synonyms Bcnp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71597648-71607936 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71599089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 23 (G23S)
Ref Sequence ENSEMBL: ENSMUSP00000123432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034264] [ENSMUST00000127626] [ENSMUST00000143441] [ENSMUST00000143662]
AlphaFold D3YZB0
Predicted Effect probably benign
Transcript: ENSMUST00000034264
SMART Domains Protein: ENSMUSP00000034264
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 217 2.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127285
Predicted Effect probably benign
Transcript: ENSMUST00000127626
SMART Domains Protein: ENSMUSP00000122042
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 214 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132891
Predicted Effect probably benign
Transcript: ENSMUST00000138742
SMART Domains Protein: ENSMUSP00000120113
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 7 174 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141594
Predicted Effect probably benign
Transcript: ENSMUST00000143441
SMART Domains Protein: ENSMUSP00000116524
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 134 3.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143662
AA Change: G23S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123432
Gene: ENSMUSG00000043243
AA Change: G23S

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
PH 68 196 4.94e-4 SMART
low complexity region 218 230 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Fam129c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam129c APN 8 71604863 splice site probably benign
IGL01530:Fam129c APN 8 71603917 splice site probably benign
IGL01553:Fam129c APN 8 71602902 missense possibly damaging 0.86
IGL02313:Fam129c APN 8 71602860 missense possibly damaging 0.92
IGL02341:Fam129c APN 8 71603799 missense possibly damaging 0.60
IGL02541:Fam129c APN 8 71602782 missense probably benign 0.07
IGL02745:Fam129c APN 8 71605038 splice site probably null
R0006:Fam129c UTSW 8 71605044 splice site probably benign
R0391:Fam129c UTSW 8 71602499 splice site probably benign
R0594:Fam129c UTSW 8 71599135 missense probably benign 0.07
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1643:Fam129c UTSW 8 71600164 missense probably benign 0.34
R1848:Fam129c UTSW 8 71603769 missense possibly damaging 0.95
R1986:Fam129c UTSW 8 71603760 missense possibly damaging 0.63
R2319:Fam129c UTSW 8 71602764 missense probably benign 0.00
R4386:Fam129c UTSW 8 71607511 intron probably benign
R4564:Fam129c UTSW 8 71605060 intron probably benign
R4666:Fam129c UTSW 8 71603825 nonsense probably null
R6341:Fam129c UTSW 8 71600077 missense probably damaging 1.00
R6888:Fam129c UTSW 8 71603739 missense probably benign
R6890:Fam129c UTSW 8 71605671 missense probably damaging 1.00
R7383:Fam129c UTSW 8 71603826 missense possibly damaging 0.86
R7441:Fam129c UTSW 8 71600164 missense probably benign 0.34
R7459:Fam129c UTSW 8 71605027 missense possibly damaging 0.75
R7527:Fam129c UTSW 8 71606698 missense probably damaging 0.99
R7873:Fam129c UTSW 8 71602248 missense probably damaging 1.00
R8698:Fam129c UTSW 8 71607515 missense unknown
R8936:Fam129c UTSW 8 71607663 utr 3 prime probably benign
R9272:Fam129c UTSW 8 71602876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCTGCTGAGTAATCTCTCC -3'
(R):5'- AGACAACTACAGCTGGGTGC -3'

Sequencing Primer
(F):5'- ACTTTGTAGACCAGACTGGC -3'
(R):5'- TACAGCTGGGTGCCTGGC -3'
Posted On 2018-04-27