Incidental Mutation 'R6364:Zcchc14'
ID513421
Institutional Source Beutler Lab
Gene Symbol Zcchc14
Ensembl Gene ENSMUSG00000061410
Gene Namezinc finger, CCHC domain containing 14
SynonymsBdg29
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6364 (G1)
Quality Score192.009
Status Validated
Chromosome8
Chromosomal Location121598703-121652901 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 121604859 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000046386] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000046386
AA Change: N588K
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410
AA Change: N588K

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139379
Predicted Effect probably benign
Transcript: ENSMUST00000154725
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Zcchc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Zcchc14 APN 8 121604615 unclassified probably benign
IGL02060:Zcchc14 APN 8 121603895 missense probably damaging 0.98
IGL02455:Zcchc14 APN 8 121606270 unclassified probably benign
IGL03196:Zcchc14 APN 8 121609138 unclassified probably benign
P0033:Zcchc14 UTSW 8 121610159 intron probably benign
R0483:Zcchc14 UTSW 8 121628649 intron probably benign
R0639:Zcchc14 UTSW 8 121605449 nonsense probably null
R1013:Zcchc14 UTSW 8 121606925 unclassified probably benign
R1129:Zcchc14 UTSW 8 121608415 unclassified probably benign
R1546:Zcchc14 UTSW 8 121604263 intron probably benign
R1563:Zcchc14 UTSW 8 121603979 missense probably benign 0.10
R1861:Zcchc14 UTSW 8 121609251 unclassified probably benign
R2200:Zcchc14 UTSW 8 121605428 unclassified probably benign
R2419:Zcchc14 UTSW 8 121603936 missense probably damaging 0.99
R4246:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4249:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4424:Zcchc14 UTSW 8 121651941 intron probably benign
R4470:Zcchc14 UTSW 8 121651759 intron probably benign
R4520:Zcchc14 UTSW 8 121609095 unclassified probably benign
R4681:Zcchc14 UTSW 8 121608600 unclassified probably benign
R5253:Zcchc14 UTSW 8 121618694 intron probably benign
R5314:Zcchc14 UTSW 8 121608598 unclassified probably benign
R5591:Zcchc14 UTSW 8 121605448 unclassified probably benign
R5746:Zcchc14 UTSW 8 121604639 unclassified probably benign
R5781:Zcchc14 UTSW 8 121604593 unclassified probably benign
R5897:Zcchc14 UTSW 8 121605160 unclassified probably benign
R5930:Zcchc14 UTSW 8 121611358 intron probably benign
R5963:Zcchc14 UTSW 8 121628623 intron probably benign
R6562:Zcchc14 UTSW 8 121604103 missense probably damaging 0.99
R6579:Zcchc14 UTSW 8 121604467 intron probably benign
R6592:Zcchc14 UTSW 8 121604639 unclassified probably benign
R6699:Zcchc14 UTSW 8 121608616 unclassified probably benign
R7195:Zcchc14 UTSW 8 121608461 missense unknown
R7420:Zcchc14 UTSW 8 121651791 intron probably benign
R7490:Zcchc14 UTSW 8 121605017 missense unknown
R7597:Zcchc14 UTSW 8 121608500 missense unknown
R7758:Zcchc14 UTSW 8 121604689 missense unknown
R7773:Zcchc14 UTSW 8 121651775 missense unknown
R7831:Zcchc14 UTSW 8 121605245 missense not run
R7889:Zcchc14 UTSW 8 121604895 missense unknown
R7919:Zcchc14 UTSW 8 121604173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATTGGCGCAGAAGCTG -3'
(R):5'- TGAACTCCGTGCACAAGTCAG -3'

Sequencing Primer
(F):5'- TGGGACAAGAAGTCTGCCC -3'
(R):5'- TCCGTGCACAAGTCAGACAGG -3'
Posted On2018-04-27