Incidental Mutation 'R6364:Mtnr1b'
ID 513422
Institutional Source Beutler Lab
Gene Symbol Mtnr1b
Ensembl Gene ENSMUSG00000050901
Gene Name melatonin receptor 1B
Synonyms Mt2, Mel1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 15824528-15874556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15863004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 253 (M253T)
Ref Sequence ENSEMBL: ENSMUSP00000138524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057920] [ENSMUST00000182947]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057920
AA Change: M253T

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053086
Gene: ENSMUSG00000050901
AA Change: M253T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 254 3.7e-11 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 3.4e-47 PFAM
Pfam:7TM_GPCR_Srv 59 317 1.1e-7 PFAM
low complexity region 348 359 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182947
AA Change: M253T

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138524
Gene: ENSMUSG00000050901
AA Change: M253T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 264 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 1.4e-50 PFAM
Pfam:7TM_GPCR_Srv 59 319 7.5e-8 PFAM
low complexity region 348 359 N/A INTRINSIC
Meta Mutation Damage Score 0.7440 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no obvious circadian phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Mtnr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Mtnr1b APN 9 15863200 missense probably damaging 1.00
IGL02041:Mtnr1b APN 9 15863293 missense probably benign 0.01
IGL02054:Mtnr1b APN 9 15874240 missense possibly damaging 0.93
IGL02147:Mtnr1b APN 9 15863376 missense probably damaging 0.96
IGL02620:Mtnr1b APN 9 15874321 missense possibly damaging 0.47
IGL03046:Mtnr1b UTSW 9 15862763 missense probably benign 0.00
R0362:Mtnr1b UTSW 9 15874304 missense probably damaging 1.00
R0784:Mtnr1b UTSW 9 15862785 missense probably benign 0.17
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1572:Mtnr1b UTSW 9 15863142 missense probably damaging 0.99
R1600:Mtnr1b UTSW 9 15863319 missense probably damaging 0.99
R2880:Mtnr1b UTSW 9 15862806 missense probably damaging 1.00
R2932:Mtnr1b UTSW 9 15874324 missense probably damaging 0.97
R4033:Mtnr1b UTSW 9 15863534 missense probably damaging 1.00
R5532:Mtnr1b UTSW 9 15862914 missense probably benign
R5765:Mtnr1b UTSW 9 15863163 missense probably damaging 1.00
R5775:Mtnr1b UTSW 9 15862872 missense possibly damaging 0.73
R5893:Mtnr1b UTSW 9 15863244 missense probably damaging 0.98
R6025:Mtnr1b UTSW 9 15862797 missense probably damaging 1.00
R6247:Mtnr1b UTSW 9 15862786 missense probably benign
R6349:Mtnr1b UTSW 9 15863213 nonsense probably null
R7485:Mtnr1b UTSW 9 15863294 nonsense probably null
R8114:Mtnr1b UTSW 9 15874267 missense probably damaging 0.98
R8707:Mtnr1b UTSW 9 15874513 start gained probably benign
R8750:Mtnr1b UTSW 9 15874428 nonsense probably null
R9405:Mtnr1b UTSW 9 15863151 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAGGATCCTCTTGTACTCCCTG -3'
(R):5'- TGCACCTTCATCCAGACAGC -3'

Sequencing Primer
(F):5'- GTTCTGGTTCAGGAGCCCATAAAC -3'
(R):5'- GCCAGCACACAGTACACGG -3'
Posted On 2018-04-27