Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Bfsp2'

513423

Institutional Source

Beutler Lab

Gene Symbol

Bfsp2

Ensembl Gene

ENSMUSG00000032556

Gene Name

beaded filament structural protein 2, phakinin

Synonyms

CP49

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103424924-103480420 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103448628 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 272 (V272D)

Ref Sequence

ENSEMBL: ENSMUSP00000116249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124310]

Predicted Effect

probably damaging
Transcript: ENSMUST00000124310
AA Change: V272D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116249
Gene: ENSMUSG00000032556
AA Change: V272D

Domain	Start	End	E-Value	Type
Filament	102	416	6.85e-79	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136636

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143564

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218189

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations at this locus result in eye abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Bfsp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Bfsp2	APN	9	103453098	missense	possibly damaging	0.90
IGL01160:Bfsp2	APN	9	103480168	missense	probably benign	0.02
R0408:Bfsp2	UTSW	9	103480100	missense	probably benign	0.06
R0463:Bfsp2	UTSW	9	103426655	missense	possibly damaging	0.94
R1454:Bfsp2	UTSW	9	103480225	start codon destroyed	probably null	0.59
R1854:Bfsp2	UTSW	9	103449831	missense	probably benign	0.01
R2139:Bfsp2	UTSW	9	103449875	missense	probably benign	0.19
R2187:Bfsp2	UTSW	9	103426777	nonsense	probably null
R3975:Bfsp2	UTSW	9	103480072	missense	probably benign	0.00
R4823:Bfsp2	UTSW	9	103479883	missense	probably damaging	1.00
R5035:Bfsp2	UTSW	9	103479866	missense	probably benign	0.35
R5973:Bfsp2	UTSW	9	103432657	critical splice donor site	probably null
R6005:Bfsp2	UTSW	9	103448550	missense	probably damaging	0.99
R6106:Bfsp2	UTSW	9	103479824	missense	probably benign	0.09
R6348:Bfsp2	UTSW	9	103480072	missense	probably benign	0.17
R6701:Bfsp2	UTSW	9	103479878	missense	possibly damaging	0.68
R6736:Bfsp2	UTSW	9	103480204	missense	possibly damaging	0.60
R7129:Bfsp2	UTSW	9	103479919	missense	probably damaging	0.99
R7204:Bfsp2	UTSW	9	103432666	missense	probably damaging	0.99
R7329:Bfsp2	UTSW	9	103449922	missense	probably benign	0.01
R7453:Bfsp2	UTSW	9	103453107	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGTTGCTAAATGGCTGCATTTC -3'
(R):5'- AGTCTTTGTGGTGCCCATGC -3'

Sequencing Primer
(F):5'- AATGGCTGCATTTCTTTTACATGCTG -3'
(R):5'- ATAGATAGATAGATAAGCAGGCCTG -3'

Posted On

2018-04-27