Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Dlec1'

513424

Institutional Source

Beutler Lab

Gene Symbol

Dlec1

Ensembl Gene

ENSMUSG00000038060

Gene Name

deleted in lung and esophageal cancer 1

Synonyms

D630005C06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119102478-119148246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119121871 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 502 (V502I)

Ref Sequence

ENSEMBL: ENSMUSP00000052645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055775
AA Change: V502I

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060
AA Change: V502I

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124213

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137047

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140326
AA Change: V502I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: V502I

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC
low complexity region	1025	1042	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165231
AA Change: V502I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: V502I

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC
low complexity region	1025	1042	N/A	INTRINSIC
low complexity region	1333	1354	N/A	INTRINSIC

Meta Mutation Damage Score

0.3779

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Dlec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Dlec1	APN	9	119102785	missense	probably benign	0.11
IGL01137:Dlec1	APN	9	119137311	missense	probably damaging	1.00
IGL01338:Dlec1	APN	9	119120911	missense	probably damaging	1.00
IGL01652:Dlec1	APN	9	119143907	missense	probably benign	0.01
IGL01923:Dlec1	APN	9	119128114	splice site	probably null
IGL02186:Dlec1	APN	9	119143627	missense	probably benign	0.00
IGL02597:Dlec1	APN	9	119134536	missense	probably damaging	0.99
IGL02667:Dlec1	APN	9	119127466	missense	probably benign	0.23
IGL02718:Dlec1	APN	9	119137286	missense	probably benign	0.01
IGL02731:Dlec1	APN	9	119147120	missense	probably benign	0.00
IGL02831:Dlec1	APN	9	119143915	missense	probably damaging	1.00
IGL03390:Dlec1	APN	9	119123220	missense	probably benign	0.00
I2288:Dlec1	UTSW	9	119143601	missense	probably damaging	1.00
R0109:Dlec1	UTSW	9	119105824	missense	probably damaging	1.00
R0144:Dlec1	UTSW	9	119142866	missense	probably benign
R0554:Dlec1	UTSW	9	119115002	missense	probably benign	0.44
R0611:Dlec1	UTSW	9	119112099	missense	probably benign	0.01
R1344:Dlec1	UTSW	9	119130017	missense	probably benign	0.09
R1467:Dlec1	UTSW	9	119142578	missense	probably damaging	1.00
R1467:Dlec1	UTSW	9	119128003	splice site	probably benign
R1467:Dlec1	UTSW	9	119142578	missense	probably damaging	1.00
R1539:Dlec1	UTSW	9	119127450	missense	probably benign	0.00
R1768:Dlec1	UTSW	9	119146007	splice site	probably null
R1809:Dlec1	UTSW	9	119136699	missense	probably benign	0.00
R1830:Dlec1	UTSW	9	119138790	missense	probably benign	0.00
R1901:Dlec1	UTSW	9	119102644	missense	probably damaging	0.99
R2060:Dlec1	UTSW	9	119112086	missense	probably damaging	1.00
R2092:Dlec1	UTSW	9	119121844	missense	possibly damaging	0.87
R2237:Dlec1	UTSW	9	119138191	critical splice donor site	probably null
R2983:Dlec1	UTSW	9	119146173	missense	probably benign	0.00
R3117:Dlec1	UTSW	9	119143903	splice site	probably null
R3816:Dlec1	UTSW	9	119124843	missense	probably damaging	1.00
R3826:Dlec1	UTSW	9	119143061	splice site	probably benign
R3965:Dlec1	UTSW	9	119128581	missense	probably benign	0.01
R4023:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4024:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4026:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4272:Dlec1	UTSW	9	119143163	missense	probably damaging	0.98
R4545:Dlec1	UTSW	9	119128078	missense	probably damaging	0.99
R4546:Dlec1	UTSW	9	119128078	missense	probably damaging	0.99
R4601:Dlec1	UTSW	9	119147134	critical splice donor site	probably null
R4695:Dlec1	UTSW	9	119143153	missense	probably benign	0.00
R4996:Dlec1	UTSW	9	119146050	missense	probably damaging	1.00
R5321:Dlec1	UTSW	9	119112601	missense	probably benign	0.02
R5521:Dlec1	UTSW	9	119143401	missense	possibly damaging	0.92
R5650:Dlec1	UTSW	9	119143594	nonsense	probably null
R5825:Dlec1	UTSW	9	119142968	missense	probably damaging	1.00
R5941:Dlec1	UTSW	9	119126312	missense	probably damaging	0.98
R6056:Dlec1	UTSW	9	119121923	missense	probably damaging	0.98
R6111:Dlec1	UTSW	9	119102624	missense	possibly damaging	0.59
R6156:Dlec1	UTSW	9	119110213	critical splice donor site	probably null
R6160:Dlec1	UTSW	9	119143319	missense	probably benign	0.02
R6195:Dlec1	UTSW	9	119137253	missense	probably benign	0.00
R6480:Dlec1	UTSW	9	119147690	missense	probably benign	0.34
R6808:Dlec1	UTSW	9	119126174	missense	probably benign	0.01
R6813:Dlec1	UTSW	9	119112102	missense	probably benign	0.02
R7019:Dlec1	UTSW	9	119112422	missense	probably benign	0.01
R7048:Dlec1	UTSW	9	119143404	splice site	probably null
R7187:Dlec1	UTSW	9	119112146	missense	probably benign	0.14
R7230:Dlec1	UTSW	9	119124538	splice site	probably null
R7585:Dlec1	UTSW	9	119142751	missense	probably benign	0.06
R8342:Dlec1	UTSW	9	119139389	missense	probably benign	0.01
Z1176:Dlec1	UTSW	9	119138786	missense	probably benign	0.13
Z1177:Dlec1	UTSW	9	119134473	missense	probably benign	0.34
Z1177:Dlec1	UTSW	9	119147409	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCAGGGTCCATTTGGAGTG -3'
(R):5'- TGGAGACTGCGACATCCTAC -3'

Sequencing Primer
(F):5'- AACTCAGGTCTTCAGATTTGGCAG -3'
(R):5'- GGAGACTGCGACATCCTACTTTTG -3'

Posted On

2018-04-27