Incidental Mutation 'R6364:Dlec1'
ID513424
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6364 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119121871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 502 (V502I)
Ref Sequence ENSEMBL: ENSMUSP00000052645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055775
AA Change: V502I

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060
AA Change: V502I

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect possibly damaging
Transcript: ENSMUST00000140326
AA Change: V502I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: V502I

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165231
AA Change: V502I

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: V502I

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.3779 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 splice site probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 splice site probably null
R7585:Dlec1 UTSW 9 119142751 missense probably benign 0.06
R8342:Dlec1 UTSW 9 119139389 missense probably benign 0.01
Z1176:Dlec1 UTSW 9 119138786 missense probably benign 0.13
Z1177:Dlec1 UTSW 9 119134473 missense probably benign 0.34
Z1177:Dlec1 UTSW 9 119147409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGGGTCCATTTGGAGTG -3'
(R):5'- TGGAGACTGCGACATCCTAC -3'

Sequencing Primer
(F):5'- AACTCAGGTCTTCAGATTTGGCAG -3'
(R):5'- GGAGACTGCGACATCCTACTTTTG -3'
Posted On2018-04-27