Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Ap3d1'

513425

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R6364 (G1)

Quality Score

221.009

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 80710494 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

Predicted Effect

probably null
Transcript: ENSMUST00000020420

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGAGAGTGCCCTATACTGATGC -3'
(R):5'- CTATCCCGGTGAGCATTCTTG -3'

Sequencing Primer
(F):5'- AGTGCCCTATACTGATGCTTGAGC -3'
(R):5'- CGGTGAGCATTCTTGACAAC -3'

Posted On

2018-04-27