Incidental Mutation 'R6364:Tbc1d30'
ID 513426
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6364 (G1)
Quality Score 129.008
Status Validated
Chromosome 10
Chromosomal Location 121263820-121351278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121294725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect possibly damaging
Transcript: ENSMUST00000064107
AA Change: T267A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: T267A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218688
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121266824 utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121296845 missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121267414 missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121267051 missense probably benign
IGL01844:Tbc1d30 APN 10 121267179 missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121267620 missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121306230 splice site probably null
R2025:Tbc1d30 UTSW 10 121279146 missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121304407 missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121272168 missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121294712 missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121279158 missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121296786 missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121267216 missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121306838 missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121302110 missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121296787 missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121267574 missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121296845 missense probably damaging 1.00
R7106:Tbc1d30 UTSW 10 121301992 missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121288965 missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121296805 missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121347156 nonsense probably null
R7958:Tbc1d30 UTSW 10 121272057 missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121306199 missense probably damaging 1.00
R8021:Tbc1d30 UTSW 10 121267543 missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121347108 nonsense probably null
R8472:Tbc1d30 UTSW 10 121351104 missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121267430 missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121351154 missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121296811 missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121275734 missense probably benign
R9282:Tbc1d30 UTSW 10 121306223 critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121267461 nonsense probably null
Z1176:Tbc1d30 UTSW 10 121302113 missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121351064 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCCACACTTTGCTCTGAGG -3'
(R):5'- AAATGTTTCCTCTAGAAAGATGGGAGG -3'

Sequencing Primer
(F):5'- CCCAAAGGCAGCTAACAGC -3'
(R):5'- CCTCTAGAAAGATGGGAGGGAAAAAG -3'
Posted On 2018-04-27