Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Serpina6'

513434

Institutional Source

Beutler Lab

Gene Symbol

Serpina6

Ensembl Gene

ENSMUSG00000060807

Gene Name

serine (or cysteine) peptidase inhibitor, clade A, member 6

Synonyms

Cbg

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103646630-103657212 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103654236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 85 (N85D)

Ref Sequence

ENSEMBL: ENSMUSP00000044033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044159] [ENSMUST00000152517]

AlphaFold

Q06770

Predicted Effect

probably benign
Transcript: ENSMUST00000044159
AA Change: N85D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044033
Gene: ENSMUSG00000060807
AA Change: N85D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SERPIN	43	396	3.45e-160	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152517

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: This gene encodes a protein that belongs to the serpin (serine protease inhibitor) family. The encoded protein is an alpha-globulin with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null homozygotes exhibit reduced total plasma corticosterone, increased susceptibility to bacterial infection, attenuation of the stress-induced surge in free corticosterone, and enhanced behavioral response to intense or uncontrollable stress. They exhibit no locomotor sensitization to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Serpina6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Serpina6	APN	12	103651903	missense	probably damaging	1.00
IGL00910:Serpina6	APN	12	103651965	unclassified	probably benign
IGL01512:Serpina6	APN	12	103654059	missense	probably damaging	0.96
IGL02994:Serpina6	APN	12	103653951	missense	probably benign	0.03
IGL03092:Serpina6	APN	12	103653895	critical splice donor site	probably null
IGL03351:Serpina6	APN	12	103646913	missense	probably damaging	1.00
R0178:Serpina6	UTSW	12	103646913	missense	probably damaging	0.98
R0362:Serpina6	UTSW	12	103651949	missense	probably damaging	0.98
R0530:Serpina6	UTSW	12	103651794	missense	probably damaging	1.00
R1542:Serpina6	UTSW	12	103654473	missense	probably benign	0.09
R1573:Serpina6	UTSW	12	103651753	missense	probably damaging	1.00
R1764:Serpina6	UTSW	12	103653923	missense	probably damaging	1.00
R2243:Serpina6	UTSW	12	103646928	missense	probably benign	0.00
R2309:Serpina6	UTSW	12	103654179	missense	probably benign	0.00
R2363:Serpina6	UTSW	12	103648609	missense	probably benign	0.00
R3691:Serpina6	UTSW	12	103654409	missense	probably benign	0.00
R4492:Serpina6	UTSW	12	103646887	missense	probably damaging	1.00
R4498:Serpina6	UTSW	12	103654067	missense	probably benign	0.02
R4953:Serpina6	UTSW	12	103651962	critical splice acceptor site	probably null
R4985:Serpina6	UTSW	12	103653936	missense	probably benign	0.00
R5022:Serpina6	UTSW	12	103651712	missense	probably damaging	1.00
R5230:Serpina6	UTSW	12	103651898	missense	probably benign	0.18
R5318:Serpina6	UTSW	12	103653962	missense	possibly damaging	0.68
R5350:Serpina6	UTSW	12	103648579	missense	possibly damaging	0.68
R5569:Serpina6	UTSW	12	103654460	missense	possibly damaging	0.90
R5664:Serpina6	UTSW	12	103654467	missense	probably damaging	0.97
R5882:Serpina6	UTSW	12	103654235	missense	probably benign	0.00
R6275:Serpina6	UTSW	12	103648720	missense	probably benign	0.01
R7173:Serpina6	UTSW	12	103646994	missense	possibly damaging	0.78
R7181:Serpina6	UTSW	12	103646944	missense	probably benign	0.00
R7725:Serpina6	UTSW	12	103648677	nonsense	probably null
R7811:Serpina6	UTSW	12	103654136	missense	probably damaging	1.00
R8418:Serpina6	UTSW	12	103646928	missense	probably damaging	0.98
R8770:Serpina6	UTSW	12	103653939	missense	probably benign	0.28
R8998:Serpina6	UTSW	12	103651729	missense	probably damaging	1.00
R8999:Serpina6	UTSW	12	103651729	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGCTTTAGTCCAGTCCTTG -3'
(R):5'- GATTCAAGTTCTCACCGAGACC -3'

Sequencing Primer
(F):5'- GGTCAAGGCCTCTGACTCATAATAG -3'
(R):5'- CTGGCTCCCACCAATGTTGAC -3'

Posted On

2018-04-27