Mutagenetix > Incidental Mutation

Incidental Mutation 'R6364:Wdr60'

513435

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

044514-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6364 (G1)

Quality Score

180.009

Status

Not validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116241732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 412 (D412E)

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349]

AlphaFold

Q8C761

Predicted Effect

probably damaging
Transcript: ENSMUST00000039349
AA Change: D412E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: D412E

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180307

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220761

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223039

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1023:Wdr60	UTSW	12	116232657	missense	probably damaging	1.00
R1065:Wdr60	UTSW	12	116256076	missense	probably damaging	0.98
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R2444:Wdr60	UTSW	12	116232669	missense	possibly damaging	0.93
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5870:Wdr60	UTSW	12	116256245	missense	possibly damaging	0.94
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
R9751:Wdr60	UTSW	12	116241783	critical splice acceptor site	probably null
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCACCTTGTACACAAAAGGGTG -3'
(R):5'- GACCACAGGTGAGGTTTTGC -3'

Sequencing Primer
(F):5'- GCAGGAGATTGCTTGCCTAATACTC -3'
(R):5'- CCCCCAGAGTAAGTAGGATAATG -3'

Posted On

2018-04-27