Incidental Mutation 'R6364:Scaf4'
ID513440
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene NameSR-related CTD-associated factor 4
SynonymsSfrs15, Sra4, Srsf15
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R6364 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location90225680-90284503 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 90260248 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 72 (Q72*)
Ref Sequence ENSEMBL: ENSMUSP00000156174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
Predicted Effect probably null
Transcript: ENSMUST00000039280
AA Change: Q72*
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: Q72*

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163419
AA Change: Q72*
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: Q72*

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231776
Predicted Effect probably null
Transcript: ENSMUST00000232371
AA Change: Q72*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90247281 missense unknown
IGL00536:Scaf4 APN 16 90257362 missense unknown
IGL01122:Scaf4 APN 16 90248630 missense unknown
IGL02015:Scaf4 APN 16 90258846 missense unknown
IGL02074:Scaf4 APN 16 90242920 missense unknown
IGL02555:Scaf4 APN 16 90250305 missense unknown
IGL02735:Scaf4 APN 16 90245515 missense unknown
FR4304:Scaf4 UTSW 16 90229854 small deletion probably benign
FR4589:Scaf4 UTSW 16 90229854 small deletion probably benign
R0217:Scaf4 UTSW 16 90242682 missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90260170 missense unknown
R0681:Scaf4 UTSW 16 90249694 missense unknown
R1099:Scaf4 UTSW 16 90263098 missense unknown
R1510:Scaf4 UTSW 16 90245394 missense unknown
R1694:Scaf4 UTSW 16 90229857 small deletion probably benign
R2077:Scaf4 UTSW 16 90252435 missense unknown
R2087:Scaf4 UTSW 16 90252425 missense unknown
R2182:Scaf4 UTSW 16 90230140 missense probably benign 0.15
R2698:Scaf4 UTSW 16 90244356 missense unknown
R2925:Scaf4 UTSW 16 90250289 missense unknown
R3025:Scaf4 UTSW 16 90251938 missense unknown
R3236:Scaf4 UTSW 16 90260217 missense unknown
R4207:Scaf4 UTSW 16 90260215 missense unknown
R4584:Scaf4 UTSW 16 90229515 unclassified probably benign
R4735:Scaf4 UTSW 16 90252432 missense unknown
R4835:Scaf4 UTSW 16 90250307 missense unknown
R4969:Scaf4 UTSW 16 90251943 nonsense probably null
R5174:Scaf4 UTSW 16 90247174 missense unknown
R5568:Scaf4 UTSW 16 90229857 small deletion probably benign
R5615:Scaf4 UTSW 16 90251960 missense unknown
R5638:Scaf4 UTSW 16 90244310 missense unknown
R6470:Scaf4 UTSW 16 90229638 nonsense probably null
R7049:Scaf4 UTSW 16 90260187 missense unknown
R7198:Scaf4 UTSW 16 90252430 missense unknown
R7446:Scaf4 UTSW 16 90258770 missense unknown
R7501:Scaf4 UTSW 16 90230076 missense unknown
R7580:Scaf4 UTSW 16 90229852 nonsense probably null
R7631:Scaf4 UTSW 16 90229557 missense unknown
R8380:Scaf4 UTSW 16 90260245 missense unknown
X0013:Scaf4 UTSW 16 90252291 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTGAACGTAAGCATTGTGTG -3'
(R):5'- CGAGCTGATGTGTGACATAGTG -3'

Sequencing Primer
(F):5'- AGCATTGTGTGAGAAATATAAAGAGG -3'
(R):5'- AGACAGTTTTACTCTGTAGCCCTGG -3'
Posted On2018-04-27