Incidental Mutation 'R6364:Bace2'
ID 513441
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms 1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97356742-97442936 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97413433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 274 (I274V)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275] [ENSMUST00000231664]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047275
AA Change: I274V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: I274V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231783
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97356941 missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97356860 missense unknown
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4112:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4563:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
R9205:Bace2 UTSW 16 97356859 missense unknown
R9221:Bace2 UTSW 16 97408492 missense probably benign 0.01
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTTACCCTGAGTAGACGC -3'
(R):5'- TTTTCCAGGAGGTCGAGAAGAG -3'

Sequencing Primer
(F):5'- CCTGAGTAGACGCTTCTCTATGGAAG -3'
(R):5'- GGCTAAACGCTGAAGCTT -3'
Posted On 2018-04-27