Incidental Mutation 'R6364:Vmn2r108'
ID 513442
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Name vomeronasal 2, receptor 108
Synonyms EG627805
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20462373-20481236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20470998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 421 (I421T)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
AlphaFold E9PYS0
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: I421T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: I421T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
R7841:Vmn2r108 UTSW 17 20470043 critical splice donor site probably null
R7944:Vmn2r108 UTSW 17 20471628 missense probably damaging 0.99
R8048:Vmn2r108 UTSW 17 20471500 missense probably benign 0.29
R8213:Vmn2r108 UTSW 17 20470088 missense probably benign 0.03
R8218:Vmn2r108 UTSW 17 20463203 missense probably damaging 1.00
R8507:Vmn2r108 UTSW 17 20462933 nonsense probably null
R8708:Vmn2r108 UTSW 17 20462425 missense probably damaging 0.98
R8845:Vmn2r108 UTSW 17 20471099 missense probably benign 0.03
R9030:Vmn2r108 UTSW 17 20470050 missense probably benign 0.01
R9226:Vmn2r108 UTSW 17 20471068 missense probably benign
R9278:Vmn2r108 UTSW 17 20472299 missense probably benign 0.11
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Z1177:Vmn2r108 UTSW 17 20470957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTTCAAACTGCATTGACCTC -3'
(R):5'- GACATTTACCTTCCTAAGTTATGGC -3'

Sequencing Primer
(F):5'- CTTCAAACTGCATTGACCTCTAAATG -3'
(R):5'- TTACCTTCCTAAGTTATGGCATTTG -3'
Posted On 2018-04-27