Incidental Mutation 'R6370:Rxrg'
List |< first << previous [record 39 of 57] next >> last >|
ID513449
Institutional Source Beutler Lab
Gene Symbol Rxrg
Ensembl Gene ENSMUSG00000015843
Gene Nameretinoid X receptor gamma
SynonymsNr2b3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167598384-167639623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167634437 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000107011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015987] [ENSMUST00000111380] [ENSMUST00000111384] [ENSMUST00000111386]
Predicted Effect probably damaging
Transcript: ENSMUST00000015987
AA Change: V350A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015987
Gene: ENSMUSG00000015843
AA Change: V350A

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 25 134 1.2e-39 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111380
AA Change: V227A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107011
Gene: ENSMUSG00000015843
AA Change: V227A

DomainStartEndE-ValueType
ZnF_C4 13 84 6.92e-39 SMART
HOLI 148 307 2.7e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111384
AA Change: V350A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107015
Gene: ENSMUSG00000015843
AA Change: V350A

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111386
AA Change: V350A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107017
Gene: ENSMUSG00000015843
AA Change: V350A

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Targeted disruption of exon 2 causes a 25% reduction of neurons in the striatum and may lead to premature death and altered responses to the administration of dopamine antagonists on some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Rxrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Rxrg APN 1 167627288 splice site probably benign
IGL01767:Rxrg APN 1 167627315 missense probably damaging 1.00
IGL02126:Rxrg APN 1 167634460 missense probably damaging 0.98
IGL03144:Rxrg APN 1 167598758 missense possibly damaging 0.53
gamma UTSW 1 167639239 missense possibly damaging 0.55
Xray UTSW 1 167631219 splice site probably benign
R0482:Rxrg UTSW 1 167631037 missense possibly damaging 0.94
R0548:Rxrg UTSW 1 167631219 splice site probably benign
R0734:Rxrg UTSW 1 167627444 missense probably damaging 1.00
R1294:Rxrg UTSW 1 167613901 missense probably benign
R1843:Rxrg UTSW 1 167598752 start codon destroyed probably benign 0.02
R2093:Rxrg UTSW 1 167627324 missense probably damaging 1.00
R2972:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R2974:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R3177:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R3277:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R4484:Rxrg UTSW 1 167625027 missense probably benign 0.03
R4721:Rxrg UTSW 1 167625052 missense probably damaging 1.00
R5267:Rxrg UTSW 1 167635766 missense probably damaging 0.98
R5323:Rxrg UTSW 1 167625004 missense probably benign
R5858:Rxrg UTSW 1 167627356 missense probably damaging 1.00
R5921:Rxrg UTSW 1 167639239 missense possibly damaging 0.55
R6142:Rxrg UTSW 1 167632622 missense possibly damaging 0.69
R6595:Rxrg UTSW 1 167627336 missense probably damaging 1.00
R6702:Rxrg UTSW 1 167613805 missense probably benign
R7133:Rxrg UTSW 1 167631109 missense probably benign 0.00
R7934:Rxrg UTSW 1 167627358 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTCTACACTGCAATCCTTAGG -3'
(R):5'- GACTGATGGCTTCTGGACTC -3'

Sequencing Primer
(F):5'- CTACACTGCAATCCTTAGGATGAGG -3'
(R):5'- CTGTCTCCGCTGAGCTTAGAAG -3'
Posted On2018-04-27