Incidental Mutation 'R6370:Usp24'
ID513459
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106380521 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1125 (K1125N)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect probably null
Transcript: ENSMUST00000094933
AA Change: K1124N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: K1124N

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165709
AA Change: K1125N

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: K1125N

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 intron probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGCCAAGCAAATCTTACTTG -3'
(R):5'- TCCCCTTTTATACCAGGAGCAC -3'

Sequencing Primer
(F):5'- ATATATATACACACACACACACACAC -3'
(R):5'- CCTTTTATACCAGGAGCACAGAGAAG -3'
Posted On2018-04-27