Incidental Mutation 'R6370:Skint5'
ID513460
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 113614110 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 983 (Q983P)
Ref Sequence ENSEMBL: ENSMUSP00000129582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105]
Predicted Effect unknown
Transcript: ENSMUST00000169631
AA Change: Q983P
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: Q983P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170105
AA Change: Q983P
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: Q983P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
R7197:Skint5 UTSW 4 113580482 critical splice donor site probably null
R7208:Skint5 UTSW 4 113539339 missense unknown
R7297:Skint5 UTSW 4 113542934 missense unknown
R7470:Skint5 UTSW 4 113756931 missense unknown
R7470:Skint5 UTSW 4 113885803 missense unknown
R7500:Skint5 UTSW 4 113559838 missense unknown
R7547:Skint5 UTSW 4 113626588 missense unknown
R7556:Skint5 UTSW 4 113567965 missense unknown
R7619:Skint5 UTSW 4 113524108 missense unknown
R7629:Skint5 UTSW 4 113942660 missense probably damaging 1.00
R7646:Skint5 UTSW 4 113763542 critical splice acceptor site probably null
R7725:Skint5 UTSW 4 113827902 missense unknown
R7788:Skint5 UTSW 4 113546518 missense unknown
R7818:Skint5 UTSW 4 113942726 missense possibly damaging 0.56
R7819:Skint5 UTSW 4 113559835 missense unknown
R7958:Skint5 UTSW 4 113623783 missense unknown
R8150:Skint5 UTSW 4 113940890 missense probably benign 0.21
R8214:Skint5 UTSW 4 113804942 splice site probably null
R8413:Skint5 UTSW 4 113715703 missense unknown
R8420:Skint5 UTSW 4 113580482 critical splice donor site probably null
R8459:Skint5 UTSW 4 113846284 nonsense probably null
R8703:Skint5 UTSW 4 113876010 missense unknown
R8710:Skint5 UTSW 4 113626590 missense unknown
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- ATACTGCTCTTTCCACCATGG -3'
(R):5'- TGAATTGCTATTGGAACAGTGAGT -3'

Sequencing Primer
(F):5'- TGGACTCTGATCTGAAACAACTG -3'
(R):5'- ACGTATCTGGAGACTAGACATTG -3'
Posted On2018-04-27