Incidental Mutation 'R6370:Slc7a1'
ID513462
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148340673 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 344 (L344P)
Ref Sequence ENSEMBL: ENSMUSP00000117781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257] [ENSMUST00000202457]
Predicted Effect probably damaging
Transcript: ENSMUST00000048116
AA Change: L344P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: L344P

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138257
AA Change: L344P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: L344P

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201860
Predicted Effect probably benign
Transcript: ENSMUST00000202457
SMART Domains Protein: ENSMUSP00000144000
Gene: ENSMUSG00000041313

DomainStartEndE-ValueType
Pfam:AA_permease 6 142 7.5e-14 PFAM
Pfam:AA_permease_2 11 142 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
R7007:Slc7a1 UTSW 5 148352446
R7635:Slc7a1 UTSW 5 148352236 missense probably damaging 0.99
R8086:Slc7a1 UTSW 5 148352089 missense probably damaging 0.99
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Z1177:Slc7a1 UTSW 5 148352165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCACAGCCGAGGAAGATTC -3'
(R):5'- TTGTGAAATGCCAGGGCTTG -3'

Sequencing Primer
(F):5'- CATGTGCTGATTTAGTAACAGCCCG -3'
(R):5'- GCTTGTAGCCCCGGGTG -3'
Posted On2018-04-27