Mutagenetix > Incidental Mutation

Incidental Mutation 'R6370:Lrrn1'

513463

Institutional Source

Beutler Lab

Gene Symbol

Lrrn1

Ensembl Gene

ENSMUSG00000034648

Gene Name

leucine rich repeat protein 1, neuronal

Synonyms

2810047E21Rik, NLRR-1

MMRRC Submission

044520-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.439) question?

Stock #

R6370 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107529768-107570214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107569224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 661 (Y661C)

Ref Sequence

ENSEMBL: ENSMUSP00000037096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049285]

AlphaFold

Q61809

Predicted Effect

probably damaging
Transcript: ENSMUST00000049285
AA Change: Y661C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037096
Gene: ENSMUSG00000034648
AA Change: Y661C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	31	76	2.89e-1	SMART
LRR	94	117	1.06e1	SMART
LRR	118	141	1.89e-1	SMART
LRR_TYP	142	165	4.3e-5	SMART
LRR	166	189	1.76e-1	SMART
LRR	214	237	4.09e1	SMART
LRR	238	261	1.53e1	SMART
LRR	262	285	2.63e0	SMART
LRR	311	335	1.45e2	SMART
LRR	336	359	4.21e1	SMART
LRRCT	371	423	2.14e-10	SMART
IGc2	438	506	6.34e-15	SMART
FN3	523	605	8.71e-2	SMART
transmembrane domain	631	653	N/A	INTRINSIC
low complexity region	690	701	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

95% (54/57)

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited decreased exploratory activity and the female mutants exhibited an increased anxiety-like response during open field testing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb6	A	G	2: 30,827,012	V67A	probably damaging	Het
Atic	T	A	1: 71,578,660	F590I	probably damaging	Het
Atxn10	T	C	15: 85,393,385	F351S	probably damaging	Het
Bcl2l13	A	G	6: 120,865,622	N92S	probably benign	Het
Carm1	G	T	9: 21,587,519	A518S	probably benign	Het
Ccar1	C	T	10: 62,764,529	R541H	probably damaging	Het
Cfhr2	A	T	1: 139,822,327	L96Q	probably damaging	Het
Chrnb4	A	G	9: 55,034,859	L377S	probably benign	Het
Clcn3	A	G	8: 60,923,024	Y639H	probably damaging	Het
Cngb1	C	T	8: 95,264,422	M717I	probably benign	Het
Ctcf	T	C	8: 105,664,220	M153T	probably benign	Het
Cyp2b19	T	C	7: 26,763,358	S222P	probably benign	Het
Dixdc1	A	T	9: 50,682,223		probably null	Het
Entpd2	G	A	2: 25,397,417	G47S	probably damaging	Het
Erbb3	A	G	10: 128,570,074	M1158T	possibly damaging	Het
Faah	T	C	4: 116,003,056	D333G	probably damaging	Het
Foxred2	T	A	15: 77,943,306	T618S	probably benign	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Gpx5	A	T	13: 21,288,702		probably null	Het
Gtdc1	A	G	2: 44,756,322	V98A	probably damaging	Het
Hal	T	C	10: 93,497,506	I312T	probably damaging	Het
Krtap21-1	T	C	16: 89,403,631	Y41C	unknown	Het
Larp6	A	G	9: 60,737,363	E262G	probably damaging	Het
Lsm14a	A	G	7: 34,357,481	V244A	probably benign	Het
Marc1	T	C	1: 184,795,492	D257G	probably damaging	Het
Mfrp	T	C	9: 44,106,261	C517R	probably damaging	Het
Ncoa3	T	C	2: 166,065,905	S1145P	probably benign	Het
Nosip	G	T	7: 45,076,740		probably null	Het
Olfr1186	T	A	2: 88,499,368	C94*	probably null	Het
Olfr568	A	T	7: 102,877,170	T17S	probably benign	Het
Olfr664	T	C	7: 104,733,917	K149R	probably benign	Het
Phykpl	T	C	11: 51,586,716	S112P	probably damaging	Het
Pik3cb	A	T	9: 99,040,934	I1015K	probably damaging	Het
Pomt2	A	G	12: 87,109,199	W818R	probably damaging	Het
Ptpn21	A	T	12: 98,689,034	M558K	possibly damaging	Het
Rnf213	T	A	11: 119,477,078	N4647K	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Homo
Rxrg	T	C	1: 167,634,437	V227A	probably damaging	Het
Satb1	A	T	17: 51,782,797	S341T	possibly damaging	Het
Skint5	T	G	4: 113,614,110	Q983P	unknown	Het
Slc6a18	G	A	13: 73,668,159	T367I	probably benign	Het
Slc7a1	A	G	5: 148,340,673	L344P	probably damaging	Het
Slc7a6	T	A	8: 106,195,437	F399I	probably benign	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sugt1	T	C	14: 79,610,334	V208A	probably benign	Het
Syt3	A	G	7: 44,395,683	K480E	probably damaging	Het
Thop1	C	T	10: 81,077,983	T186I	probably benign	Het
Trim55	G	A	3: 19,691,486	E509K	possibly damaging	Het
Upf2	A	G	2: 5,976,010	N469S	unknown	Het
Usp24	G	T	4: 106,380,521	K1125N	probably null	Het
Usp5	A	T	6: 124,820,428	D494E	probably benign	Het
Vmn2r51	T	C	7: 10,098,216	K481R	probably damaging	Het
Vps16	C	A	2: 130,443,384	A787D	probably damaging	Het
Washc4	C	T	10: 83,571,362	H488Y	possibly damaging	Het
Wdfy4	C	A	14: 33,068,850	A2053S	probably benign	Het
Zfp74	A	T	7: 29,932,410	D136E	probably damaging	Het

Other mutations in Lrrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrrn1	APN	6	107568308	missense	probably benign	0.06
IGL00949:Lrrn1	APN	6	107569300	missense	probably benign	0.15
IGL01594:Lrrn1	APN	6	107567493	missense	probably damaging	0.99
IGL02814:Lrrn1	APN	6	107567352	missense	probably damaging	1.00
IGL02824:Lrrn1	APN	6	107568534	missense	possibly damaging	0.57
IGL02931:Lrrn1	APN	6	107567748	missense	probably damaging	1.00
R0399:Lrrn1	UTSW	6	107569120	missense	probably benign
R1109:Lrrn1	UTSW	6	107567264	missense	probably benign
R1620:Lrrn1	UTSW	6	107568366	missense	probably damaging	1.00
R1826:Lrrn1	UTSW	6	107567568	missense	probably benign	0.05
R1893:Lrrn1	UTSW	6	107568122	missense	possibly damaging	0.82
R2327:Lrrn1	UTSW	6	107568833	missense	probably benign	0.05
R3684:Lrrn1	UTSW	6	107567949	missense	probably benign	0.13
R3757:Lrrn1	UTSW	6	107569208	missense	possibly damaging	0.81
R4538:Lrrn1	UTSW	6	107568637	missense	probably benign	0.21
R4922:Lrrn1	UTSW	6	107568350	missense	probably damaging	1.00
R4946:Lrrn1	UTSW	6	107568890	missense	probably benign	0.16
R4970:Lrrn1	UTSW	6	107569344	missense	probably benign	0.06
R4977:Lrrn1	UTSW	6	107568707	missense	probably benign
R5121:Lrrn1	UTSW	6	107569207	missense	possibly damaging	0.89
R5186:Lrrn1	UTSW	6	107569224	missense	probably damaging	1.00
R5625:Lrrn1	UTSW	6	107567354	missense	probably damaging	0.99
R5736:Lrrn1	UTSW	6	107567384	missense	probably damaging	1.00
R5873:Lrrn1	UTSW	6	107568975	missense	probably damaging	0.98
R5949:Lrrn1	UTSW	6	107567504	missense	probably benign	0.00
R6046:Lrrn1	UTSW	6	107568527	missense	probably benign	0.00
R7138:Lrrn1	UTSW	6	107568375	missense	probably damaging	1.00
R7169:Lrrn1	UTSW	6	107567604	missense	probably damaging	1.00
R7413:Lrrn1	UTSW	6	107569122	missense	probably benign	0.00
R7449:Lrrn1	UTSW	6	107568521	missense	possibly damaging	0.91
R7969:Lrrn1	UTSW	6	107567850	missense	probably damaging	1.00
R8077:Lrrn1	UTSW	6	107568822	missense	probably damaging	0.99
R8288:Lrrn1	UTSW	6	107566994	start gained	probably benign
R8420:Lrrn1	UTSW	6	107569333	missense	probably benign	0.00
R8725:Lrrn1	UTSW	6	107567342	nonsense	probably null
R9007:Lrrn1	UTSW	6	107567859	missense	probably damaging	0.99
R9133:Lrrn1	UTSW	6	107567607	missense	probably damaging	1.00
R9367:Lrrn1	UTSW	6	107568132	missense	probably damaging	0.98
R9373:Lrrn1	UTSW	6	107568504	missense	possibly damaging	0.82
R9475:Lrrn1	UTSW	6	107568300	missense	probably damaging	1.00
R9513:Lrrn1	UTSW	6	107568544	missense	probably benign	0.04
R9516:Lrrn1	UTSW	6	107568544	missense	probably benign	0.04
R9549:Lrrn1	UTSW	6	107569017	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGTGTCCAACATCCATCAG -3'
(R):5'- TGTGCTCCTTACTACCAGAAGC -3'

Sequencing Primer
(F):5'- GTGTCCAACATCCATCAGCAGAC -3'
(R):5'- GTGCTCCTTACTACCAGAAGCAAAAC -3'

Posted On

2018-04-27