Mutagenetix > Incidental Mutation

Incidental Mutation 'R6370:Usp5'

513465

Institutional Source

Beutler Lab

Gene Symbol

Usp5

Ensembl Gene

ENSMUSG00000038429

Gene Name

ubiquitin specific peptidase 5 (isopeptidase T)

Synonyms

Ucht

MMRRC Submission

044520-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6370 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124815019-124829484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124820428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 494 (D494E)

Ref Sequence

ENSEMBL: ENSMUSP00000041299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]

AlphaFold

P56399

Predicted Effect

probably benign
Transcript: ENSMUST00000047510
AA Change: D494E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: D494E

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	656	694	3.12e-7	SMART
UBA	724	761	8.63e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122110
AA Change: D494E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: D494E

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	633	671	3.12e-7	SMART
UBA	701	738	8.63e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141042

Predicted Effect

probably benign
Transcript: ENSMUST00000142058

SMART Domains

Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-20	BLAST
ZnF_UBP	180	235	6.47e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146098

Predicted Effect

probably benign
Transcript: ENSMUST00000153306

SMART Domains

Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
Blast:ZnF_UBP	1	32	3e-7	BLAST
ZnF_UBP	152	207	6.47e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154189

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

95% (54/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb6	A	G	2: 30,827,012	V67A	probably damaging	Het
Atic	T	A	1: 71,578,660	F590I	probably damaging	Het
Atxn10	T	C	15: 85,393,385	F351S	probably damaging	Het
Bcl2l13	A	G	6: 120,865,622	N92S	probably benign	Het
Carm1	G	T	9: 21,587,519	A518S	probably benign	Het
Ccar1	C	T	10: 62,764,529	R541H	probably damaging	Het
Cfhr2	A	T	1: 139,822,327	L96Q	probably damaging	Het
Chrnb4	A	G	9: 55,034,859	L377S	probably benign	Het
Clcn3	A	G	8: 60,923,024	Y639H	probably damaging	Het
Cngb1	C	T	8: 95,264,422	M717I	probably benign	Het
Ctcf	T	C	8: 105,664,220	M153T	probably benign	Het
Cyp2b19	T	C	7: 26,763,358	S222P	probably benign	Het
Dixdc1	A	T	9: 50,682,223		probably null	Het
Entpd2	G	A	2: 25,397,417	G47S	probably damaging	Het
Erbb3	A	G	10: 128,570,074	M1158T	possibly damaging	Het
Faah	T	C	4: 116,003,056	D333G	probably damaging	Het
Foxred2	T	A	15: 77,943,306	T618S	probably benign	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Gpx5	A	T	13: 21,288,702		probably null	Het
Gtdc1	A	G	2: 44,756,322	V98A	probably damaging	Het
Hal	T	C	10: 93,497,506	I312T	probably damaging	Het
Krtap21-1	T	C	16: 89,403,631	Y41C	unknown	Het
Larp6	A	G	9: 60,737,363	E262G	probably damaging	Het
Lrrn1	A	G	6: 107,569,224	Y661C	probably damaging	Het
Lsm14a	A	G	7: 34,357,481	V244A	probably benign	Het
Marc1	T	C	1: 184,795,492	D257G	probably damaging	Het
Mfrp	T	C	9: 44,106,261	C517R	probably damaging	Het
Ncoa3	T	C	2: 166,065,905	S1145P	probably benign	Het
Nosip	G	T	7: 45,076,740		probably null	Het
Olfr1186	T	A	2: 88,499,368	C94*	probably null	Het
Olfr568	A	T	7: 102,877,170	T17S	probably benign	Het
Olfr664	T	C	7: 104,733,917	K149R	probably benign	Het
Phykpl	T	C	11: 51,586,716	S112P	probably damaging	Het
Pik3cb	A	T	9: 99,040,934	I1015K	probably damaging	Het
Pomt2	A	G	12: 87,109,199	W818R	probably damaging	Het
Ptpn21	A	T	12: 98,689,034	M558K	possibly damaging	Het
Rnf213	T	A	11: 119,477,078	N4647K	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Homo
Rxrg	T	C	1: 167,634,437	V227A	probably damaging	Het
Satb1	A	T	17: 51,782,797	S341T	possibly damaging	Het
Skint5	T	G	4: 113,614,110	Q983P	unknown	Het
Slc6a18	G	A	13: 73,668,159	T367I	probably benign	Het
Slc7a1	A	G	5: 148,340,673	L344P	probably damaging	Het
Slc7a6	T	A	8: 106,195,437	F399I	probably benign	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sugt1	T	C	14: 79,610,334	V208A	probably benign	Het
Syt3	A	G	7: 44,395,683	K480E	probably damaging	Het
Thop1	C	T	10: 81,077,983	T186I	probably benign	Het
Trim55	G	A	3: 19,691,486	E509K	possibly damaging	Het
Upf2	A	G	2: 5,976,010	N469S	unknown	Het
Usp24	G	T	4: 106,380,521	K1125N	probably null	Het
Vmn2r51	T	C	7: 10,098,216	K481R	probably damaging	Het
Vps16	C	A	2: 130,443,384	A787D	probably damaging	Het
Washc4	C	T	10: 83,571,362	H488Y	possibly damaging	Het
Wdfy4	C	A	14: 33,068,850	A2053S	probably benign	Het
Zfp74	A	T	7: 29,932,410	D136E	probably damaging	Het

Other mutations in Usp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Usp5	APN	6	124829353	missense	probably benign	0.00
IGL00905:Usp5	APN	6	124815613	missense	probably damaging	1.00
IGL01584:Usp5	APN	6	124819387	missense	probably damaging	1.00
IGL01642:Usp5	APN	6	124820453	missense	probably damaging	0.99
IGL01787:Usp5	APN	6	124824226	missense	possibly damaging	0.95
IGL02394:Usp5	APN	6	124822709	missense	probably damaging	1.00
IGL02677:Usp5	APN	6	124819426	missense	probably damaging	1.00
IGL03392:Usp5	APN	6	124826387	missense	probably damaging	1.00
BB004:Usp5	UTSW	6	124824229	missense	probably benign	0.06
BB014:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R0594:Usp5	UTSW	6	124817424	missense	probably damaging	0.99
R1522:Usp5	UTSW	6	124825166	missense	probably benign
R1719:Usp5	UTSW	6	124823460	missense	possibly damaging	0.94
R2185:Usp5	UTSW	6	124817410	missense	probably damaging	0.99
R3115:Usp5	UTSW	6	124815597	missense	probably damaging	1.00
R4196:Usp5	UTSW	6	124824938	missense	possibly damaging	0.78
R4347:Usp5	UTSW	6	124821195	missense	probably damaging	1.00
R4386:Usp5	UTSW	6	124818474	critical splice donor site	probably null
R4500:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4501:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4526:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4527:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4528:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4684:Usp5	UTSW	6	124817956	missense	probably damaging	1.00
R4912:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4913:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4954:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4956:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4957:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4958:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R5071:Usp5	UTSW	6	124826379	missense	probably benign	0.13
R6020:Usp5	UTSW	6	124817613	unclassified	probably benign
R6236:Usp5	UTSW	6	124818478	missense	probably benign	0.05
R7090:Usp5	UTSW	6	124829394	start codon destroyed	probably null
R7317:Usp5	UTSW	6	124826318	missense	probably damaging	0.98
R7447:Usp5	UTSW	6	124821114	missense	probably damaging	1.00
R7572:Usp5	UTSW	6	124818007	missense	probably damaging	0.99
R7598:Usp5	UTSW	6	124826379	missense	possibly damaging	0.73
R7927:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R7931:Usp5	UTSW	6	124824446	intron	probably benign
R8089:Usp5	UTSW	6	124820410	critical splice donor site	probably null
R8361:Usp5	UTSW	6	124824985	missense	probably damaging	1.00
R8544:Usp5	UTSW	6	124823517	missense	probably damaging	1.00
R8679:Usp5	UTSW	6	124817431	missense	possibly damaging	0.94
R9115:Usp5	UTSW	6	124826421	missense	probably damaging	0.97
R9128:Usp5	UTSW	6	124823451	critical splice donor site	probably null
R9227:Usp5	UTSW	6	124818636	missense	probably damaging	1.00
R9651:Usp5	UTSW	6	124822538	missense	possibly damaging	0.91
X0058:Usp5	UTSW	6	124824176	missense	probably damaging	1.00
Z1177:Usp5	UTSW	6	124825148	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTGCTTGACTTAGCCTGCTG -3'
(R):5'- TGAGCCTCAATTTGTTCTCTGG -3'

Sequencing Primer
(F):5'- GCCTCGTGCCCCAAGTTATTC -3'
(R):5'- TGGCTGCCCAGACCTTC -3'

Posted On

2018-04-27