Incidental Mutation 'R6370:Usp5'
ID513465
Institutional Source Beutler Lab
Gene Symbol Usp5
Ensembl Gene ENSMUSG00000038429
Gene Nameubiquitin specific peptidase 5 (isopeptidase T)
SynonymsUcht
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124815019-124829484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124820428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 494 (D494E)
Ref Sequence ENSEMBL: ENSMUSP00000041299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]
Predicted Effect probably benign
Transcript: ENSMUST00000047510
AA Change: D494E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: D494E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
AA Change: D494E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: D494E

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141042
Predicted Effect probably benign
Transcript: ENSMUST00000142058
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146098
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154189
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Usp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp5 APN 6 124829353 missense probably benign 0.00
IGL00905:Usp5 APN 6 124815613 missense probably damaging 1.00
IGL01584:Usp5 APN 6 124819387 missense probably damaging 1.00
IGL01642:Usp5 APN 6 124820453 missense probably damaging 0.99
IGL01787:Usp5 APN 6 124824226 missense possibly damaging 0.95
IGL02394:Usp5 APN 6 124822709 missense probably damaging 1.00
IGL02677:Usp5 APN 6 124819426 missense probably damaging 1.00
IGL03392:Usp5 APN 6 124826387 missense probably damaging 1.00
BB004:Usp5 UTSW 6 124824229 missense probably benign 0.06
BB014:Usp5 UTSW 6 124824229 missense probably benign 0.06
R0594:Usp5 UTSW 6 124817424 missense probably damaging 0.99
R1522:Usp5 UTSW 6 124825166 missense probably benign
R1719:Usp5 UTSW 6 124823460 missense possibly damaging 0.94
R2185:Usp5 UTSW 6 124817410 missense probably damaging 0.99
R3115:Usp5 UTSW 6 124815597 missense probably damaging 1.00
R4196:Usp5 UTSW 6 124824938 missense possibly damaging 0.78
R4347:Usp5 UTSW 6 124821195 missense probably damaging 1.00
R4386:Usp5 UTSW 6 124818474 critical splice donor site probably null
R4500:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4501:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4526:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4527:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4528:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4684:Usp5 UTSW 6 124817956 missense probably damaging 1.00
R4912:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4913:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4954:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4956:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4957:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4958:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R5071:Usp5 UTSW 6 124826379 missense probably benign 0.13
R6020:Usp5 UTSW 6 124817613 unclassified probably benign
R6236:Usp5 UTSW 6 124818478 missense probably benign 0.05
R7090:Usp5 UTSW 6 124829394 start codon destroyed probably null
R7317:Usp5 UTSW 6 124826318 missense probably damaging 0.98
R7447:Usp5 UTSW 6 124821114 missense probably damaging 1.00
R7572:Usp5 UTSW 6 124818007 missense probably damaging 0.99
R7598:Usp5 UTSW 6 124826379 missense possibly damaging 0.73
R7927:Usp5 UTSW 6 124824229 missense probably benign 0.06
R8089:Usp5 UTSW 6 124820410 critical splice donor site probably null
X0058:Usp5 UTSW 6 124824176 missense probably damaging 1.00
Z1177:Usp5 UTSW 6 124825148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCTTGACTTAGCCTGCTG -3'
(R):5'- TGAGCCTCAATTTGTTCTCTGG -3'

Sequencing Primer
(F):5'- GCCTCGTGCCCCAAGTTATTC -3'
(R):5'- TGGCTGCCCAGACCTTC -3'
Posted On2018-04-27