Incidental Mutation 'R6370:Vmn2r51'
ID 513466
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 044520-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9832143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 481 (K481R)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: K481R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: K481R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,717,024 (GRCm39) V67A probably damaging Het
Atic T A 1: 71,617,819 (GRCm39) F590I probably damaging Het
Atxn10 T C 15: 85,277,586 (GRCm39) F351S probably damaging Het
Bcl2l13 A G 6: 120,842,583 (GRCm39) N92S probably benign Het
Carm1 G T 9: 21,498,815 (GRCm39) A518S probably benign Het
Ccar1 C T 10: 62,600,308 (GRCm39) R541H probably damaging Het
Cfhr2 A T 1: 139,750,065 (GRCm39) L96Q probably damaging Het
Chrnb4 A G 9: 54,942,143 (GRCm39) L377S probably benign Het
Clcn3 A G 8: 61,376,058 (GRCm39) Y639H probably damaging Het
Cngb1 C T 8: 95,991,050 (GRCm39) M717I probably benign Het
Ctcf T C 8: 106,390,852 (GRCm39) M153T probably benign Het
Cyp2b19 T C 7: 26,462,783 (GRCm39) S222P probably benign Het
Dixdc1 A T 9: 50,593,523 (GRCm39) probably null Het
Entpd2 G A 2: 25,287,429 (GRCm39) G47S probably damaging Het
Erbb3 A G 10: 128,405,943 (GRCm39) M1158T possibly damaging Het
Faah T C 4: 115,860,253 (GRCm39) D333G probably damaging Het
Foxred2 T A 15: 77,827,506 (GRCm39) T618S probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpx5 A T 13: 21,472,872 (GRCm39) probably null Het
Gtdc1 A G 2: 44,646,334 (GRCm39) V98A probably damaging Het
Hal T C 10: 93,333,368 (GRCm39) I312T probably damaging Het
Krtap21-1 T C 16: 89,200,519 (GRCm39) Y41C unknown Het
Larp6 A G 9: 60,644,646 (GRCm39) E262G probably damaging Het
Lrrn1 A G 6: 107,546,185 (GRCm39) Y661C probably damaging Het
Lsm14a A G 7: 34,056,906 (GRCm39) V244A probably benign Het
Mfrp T C 9: 44,017,558 (GRCm39) C517R probably damaging Het
Mtarc1 T C 1: 184,527,689 (GRCm39) D257G probably damaging Het
Ncoa3 T C 2: 165,907,825 (GRCm39) S1145P probably benign Het
Nosip G T 7: 44,726,164 (GRCm39) probably null Het
Or4c100 T A 2: 88,329,712 (GRCm39) C94* probably null Het
Or51f2 A T 7: 102,526,377 (GRCm39) T17S probably benign Het
Or52n1 T C 7: 104,383,124 (GRCm39) K149R probably benign Het
Phykpl T C 11: 51,477,543 (GRCm39) S112P probably damaging Het
Pik3cb A T 9: 98,922,987 (GRCm39) I1015K probably damaging Het
Pomt2 A G 12: 87,155,973 (GRCm39) W818R probably damaging Het
Ptpn21 A T 12: 98,655,293 (GRCm39) M558K possibly damaging Het
Rnf213 T A 11: 119,367,904 (GRCm39) N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Rxrg T C 1: 167,462,006 (GRCm39) V227A probably damaging Het
Satb1 A T 17: 52,089,825 (GRCm39) S341T possibly damaging Het
Skint5 T G 4: 113,471,307 (GRCm39) Q983P unknown Het
Slc6a18 G A 13: 73,816,278 (GRCm39) T367I probably benign Het
Slc7a1 A G 5: 148,277,483 (GRCm39) L344P probably damaging Het
Slc7a6 T A 8: 106,922,069 (GRCm39) F399I probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sugt1 T C 14: 79,847,774 (GRCm39) V208A probably benign Het
Syt3 A G 7: 44,045,107 (GRCm39) K480E probably damaging Het
Thop1 C T 10: 80,913,817 (GRCm39) T186I probably benign Het
Trim55 G A 3: 19,745,650 (GRCm39) E509K possibly damaging Het
Upf2 A G 2: 5,980,821 (GRCm39) N469S unknown Het
Usp24 G T 4: 106,237,718 (GRCm39) K1125N probably null Het
Usp5 A T 6: 124,797,391 (GRCm39) D494E probably benign Het
Vps16 C A 2: 130,285,304 (GRCm39) A787D probably damaging Het
Washc4 C T 10: 83,407,226 (GRCm39) H488Y possibly damaging Het
Wdfy4 C A 14: 32,790,807 (GRCm39) A2053S probably benign Het
Zfp74 A T 7: 29,631,835 (GRCm39) D136E probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCTTTCAATGTGTTGCCGTG -3'
(R):5'- GCAATTGCATTTGTTGTGATTCCTC -3'

Sequencing Primer
(F):5'- GCCGTGTATTCATCTGACACTG -3'
(R):5'- TGCCTTTGCTATGAAATCAGAATG -3'
Posted On 2018-04-27