Incidental Mutation 'R6370:Vmn2r51'
ID 513466
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 10087198-10105659 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10098216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 481 (K481R)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: K481R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: K481R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 10102414 missense probably benign
IGL01574:Vmn2r51 APN 7 10102454 missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 10100227 missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 10105482 missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 10100316 missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 10098119 splice site probably benign
IGL02834:Vmn2r51 APN 7 10098136 nonsense probably null
R0617:Vmn2r51 UTSW 7 10100469 missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 10100085 missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 10102445 missense possibly damaging 0.58
R1559:Vmn2r51 UTSW 7 10102446 missense possibly damaging 0.87
R1598:Vmn2r51 UTSW 7 10105505 missense probably benign
R1754:Vmn2r51 UTSW 7 10099946 missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 10098163 nonsense probably null
R1836:Vmn2r51 UTSW 7 10098164 nonsense probably null
R3151:Vmn2r51 UTSW 7 10100041 missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 10102414 missense probably benign
R4933:Vmn2r51 UTSW 7 10098320 missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 10088005 missense probably benign
R5050:Vmn2r51 UTSW 7 10100422 missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 10102618 missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 10092201 missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 10105631 missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 10087994 missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 10098237 missense probably benign 0.00
R6471:Vmn2r51 UTSW 7 10102583 missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 10098264 missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 10100098 missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 10100553 missense probably null 1.00
R7246:Vmn2r51 UTSW 7 10102501 missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 10100026 missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 10105553 missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 10099785 critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 10099889 missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 10105552 missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 10105480 missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 10088057 missense possibly damaging 0.76
Z1176:Vmn2r51 UTSW 7 10099908 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTTCAATGTGTTGCCGTG -3'
(R):5'- GCAATTGCATTTGTTGTGATTCCTC -3'

Sequencing Primer
(F):5'- GCCGTGTATTCATCTGACACTG -3'
(R):5'- TGCCTTTGCTATGAAATCAGAATG -3'
Posted On 2018-04-27