Incidental Mutation 'R6370:Vmn2r51'
ID 513466
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 10087198-10105659 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10098216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 481 (K481R)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: K481R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: K481R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 10102414 missense probably benign
IGL01574:Vmn2r51 APN 7 10102454 missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 10100227 missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 10105482 missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 10100316 missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 10098119 splice site probably benign
IGL02834:Vmn2r51 APN 7 10098136 nonsense probably null
R0617:Vmn2r51 UTSW 7 10100469 missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 10100085 missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 10102445 missense possibly damaging 0.58
R1559:Vmn2r51 UTSW 7 10102446 missense possibly damaging 0.87
R1598:Vmn2r51 UTSW 7 10105505 missense probably benign
R1754:Vmn2r51 UTSW 7 10099946 missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 10098163 nonsense probably null
R1836:Vmn2r51 UTSW 7 10098164 nonsense probably null
R3151:Vmn2r51 UTSW 7 10100041 missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 10102414 missense probably benign
R4933:Vmn2r51 UTSW 7 10098320 missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 10088005 missense probably benign
R5050:Vmn2r51 UTSW 7 10100422 missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 10102618 missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 10092201 missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 10105631 missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 10087994 missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 10098237 missense probably benign 0.00
R6471:Vmn2r51 UTSW 7 10102583 missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 10098264 missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 10100098 missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 10100553 missense probably null 1.00
R7246:Vmn2r51 UTSW 7 10102501 missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 10100026 missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 10105553 missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 10099785 critical splice donor site probably benign
Z1176:Vmn2r51 UTSW 7 10088057 missense possibly damaging 0.76
Z1176:Vmn2r51 UTSW 7 10099908 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTTCAATGTGTTGCCGTG -3'
(R):5'- GCAATTGCATTTGTTGTGATTCCTC -3'

Sequencing Primer
(F):5'- GCCGTGTATTCATCTGACACTG -3'
(R):5'- TGCCTTTGCTATGAAATCAGAATG -3'
Posted On 2018-04-27