Incidental Mutation 'R6370:Cyp2b19'
ID 513467
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 044520-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26456567-26472055 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26462783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect probably benign
Transcript: ENSMUST00000077855
AA Change: S222P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: S222P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,717,024 (GRCm39) V67A probably damaging Het
Atic T A 1: 71,617,819 (GRCm39) F590I probably damaging Het
Atxn10 T C 15: 85,277,586 (GRCm39) F351S probably damaging Het
Bcl2l13 A G 6: 120,842,583 (GRCm39) N92S probably benign Het
Carm1 G T 9: 21,498,815 (GRCm39) A518S probably benign Het
Ccar1 C T 10: 62,600,308 (GRCm39) R541H probably damaging Het
Cfhr2 A T 1: 139,750,065 (GRCm39) L96Q probably damaging Het
Chrnb4 A G 9: 54,942,143 (GRCm39) L377S probably benign Het
Clcn3 A G 8: 61,376,058 (GRCm39) Y639H probably damaging Het
Cngb1 C T 8: 95,991,050 (GRCm39) M717I probably benign Het
Ctcf T C 8: 106,390,852 (GRCm39) M153T probably benign Het
Dixdc1 A T 9: 50,593,523 (GRCm39) probably null Het
Entpd2 G A 2: 25,287,429 (GRCm39) G47S probably damaging Het
Erbb3 A G 10: 128,405,943 (GRCm39) M1158T possibly damaging Het
Faah T C 4: 115,860,253 (GRCm39) D333G probably damaging Het
Foxred2 T A 15: 77,827,506 (GRCm39) T618S probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpx5 A T 13: 21,472,872 (GRCm39) probably null Het
Gtdc1 A G 2: 44,646,334 (GRCm39) V98A probably damaging Het
Hal T C 10: 93,333,368 (GRCm39) I312T probably damaging Het
Krtap21-1 T C 16: 89,200,519 (GRCm39) Y41C unknown Het
Larp6 A G 9: 60,644,646 (GRCm39) E262G probably damaging Het
Lrrn1 A G 6: 107,546,185 (GRCm39) Y661C probably damaging Het
Lsm14a A G 7: 34,056,906 (GRCm39) V244A probably benign Het
Mfrp T C 9: 44,017,558 (GRCm39) C517R probably damaging Het
Mtarc1 T C 1: 184,527,689 (GRCm39) D257G probably damaging Het
Ncoa3 T C 2: 165,907,825 (GRCm39) S1145P probably benign Het
Nosip G T 7: 44,726,164 (GRCm39) probably null Het
Or4c100 T A 2: 88,329,712 (GRCm39) C94* probably null Het
Or51f2 A T 7: 102,526,377 (GRCm39) T17S probably benign Het
Or52n1 T C 7: 104,383,124 (GRCm39) K149R probably benign Het
Phykpl T C 11: 51,477,543 (GRCm39) S112P probably damaging Het
Pik3cb A T 9: 98,922,987 (GRCm39) I1015K probably damaging Het
Pomt2 A G 12: 87,155,973 (GRCm39) W818R probably damaging Het
Ptpn21 A T 12: 98,655,293 (GRCm39) M558K possibly damaging Het
Rnf213 T A 11: 119,367,904 (GRCm39) N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Rxrg T C 1: 167,462,006 (GRCm39) V227A probably damaging Het
Satb1 A T 17: 52,089,825 (GRCm39) S341T possibly damaging Het
Skint5 T G 4: 113,471,307 (GRCm39) Q983P unknown Het
Slc6a18 G A 13: 73,816,278 (GRCm39) T367I probably benign Het
Slc7a1 A G 5: 148,277,483 (GRCm39) L344P probably damaging Het
Slc7a6 T A 8: 106,922,069 (GRCm39) F399I probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sugt1 T C 14: 79,847,774 (GRCm39) V208A probably benign Het
Syt3 A G 7: 44,045,107 (GRCm39) K480E probably damaging Het
Thop1 C T 10: 80,913,817 (GRCm39) T186I probably benign Het
Trim55 G A 3: 19,745,650 (GRCm39) E509K possibly damaging Het
Upf2 A G 2: 5,980,821 (GRCm39) N469S unknown Het
Usp24 G T 4: 106,237,718 (GRCm39) K1125N probably null Het
Usp5 A T 6: 124,797,391 (GRCm39) D494E probably benign Het
Vmn2r51 T C 7: 9,832,143 (GRCm39) K481R probably damaging Het
Vps16 C A 2: 130,285,304 (GRCm39) A787D probably damaging Het
Washc4 C T 10: 83,407,226 (GRCm39) H488Y possibly damaging Het
Wdfy4 C A 14: 32,790,807 (GRCm39) A2053S probably benign Het
Zfp74 A T 7: 29,631,835 (GRCm39) D136E probably damaging Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26,458,842 (GRCm39) missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26,458,504 (GRCm39) missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26,458,489 (GRCm39) missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26,461,803 (GRCm39) missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26,461,809 (GRCm39) missense probably benign
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26,466,187 (GRCm39) missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26,461,654 (GRCm39) splice site probably benign
R1514:Cyp2b19 UTSW 7 26,466,585 (GRCm39) missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26,462,765 (GRCm39) splice site probably null
R2362:Cyp2b19 UTSW 7 26,463,802 (GRCm39) missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26,462,807 (GRCm39) missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26,470,819 (GRCm39) missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26,456,717 (GRCm39) missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26,463,801 (GRCm39) missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26,466,246 (GRCm39) missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26,462,844 (GRCm39) missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26,458,852 (GRCm39) missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26,458,519 (GRCm39) missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26,470,817 (GRCm39) missense possibly damaging 0.91
R6519:Cyp2b19 UTSW 7 26,458,536 (GRCm39) missense probably benign
R6656:Cyp2b19 UTSW 7 26,466,280 (GRCm39) missense probably benign
R7283:Cyp2b19 UTSW 7 26,466,339 (GRCm39) missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26,458,489 (GRCm39) missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26,470,769 (GRCm39) missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26,466,565 (GRCm39) missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26,470,675 (GRCm39) missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26,456,645 (GRCm39) missense possibly damaging 0.53
R9574:Cyp2b19 UTSW 7 26,466,353 (GRCm39) missense probably null 1.00
R9574:Cyp2b19 UTSW 7 26,466,352 (GRCm39) missense probably damaging 1.00
R9650:Cyp2b19 UTSW 7 26,466,208 (GRCm39) missense possibly damaging 0.85
R9681:Cyp2b19 UTSW 7 26,466,328 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTAGAGACAATTTGGAACTACAG -3'
(R):5'- GACTAACCTTCTCCATGCGC -3'

Sequencing Primer
(F):5'- CAGTTCAAAAGCATGCATGTGTATGG -3'
(R):5'- TTCTCCATGCGCAGAAGGTAG -3'
Posted On 2018-04-27