Incidental Mutation 'R6370:Cyp2b19'
List |< first << previous [record 12 of 57] next >> last >|
ID513467
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26757142-26772630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26763358 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
Predicted Effect probably benign
Transcript: ENSMUST00000077855
AA Change: S222P

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: S222P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26759417 missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26759079 missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26759064 missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26762378 missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26762384 missense probably benign
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26766762 missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26762229 splice site probably benign
R1514:Cyp2b19 UTSW 7 26767160 missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26763340 splice site probably null
R2362:Cyp2b19 UTSW 7 26764377 missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26763382 missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26771394 missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26757292 missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26764376 missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26766821 missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26763419 missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26759427 missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26759094 missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26771392 missense possibly damaging 0.91
R6519:Cyp2b19 UTSW 7 26759111 missense probably benign
R6656:Cyp2b19 UTSW 7 26766855 missense probably benign
R7283:Cyp2b19 UTSW 7 26766914 missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26759064 missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26771344 missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26767140 missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26771250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAGAGACAATTTGGAACTACAG -3'
(R):5'- GACTAACCTTCTCCATGCGC -3'

Sequencing Primer
(F):5'- CAGTTCAAAAGCATGCATGTGTATGG -3'
(R):5'- TTCTCCATGCGCAGAAGGTAG -3'
Posted On2018-04-27