Incidental Mutation 'R6370:Lsm14a'
ID513469
Institutional Source Beutler Lab
Gene Symbol Lsm14a
Ensembl Gene ENSMUSG00000066568
Gene NameLSM14A mRNA processing body assembly factor
SynonymsTral, 2700023B17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location34344646-34393315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34357481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 244 (V244A)
Ref Sequence ENSEMBL: ENSMUSP00000082723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085585] [ENSMUST00000133046] [ENSMUST00000155256] [ENSMUST00000206388]
Predicted Effect probably benign
Transcript: ENSMUST00000085585
AA Change: V244A

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082723
Gene: ENSMUSG00000066568
AA Change: V244A

DomainStartEndE-ValueType
LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
FDF 289 399 6.14e-35 SMART
low complexity region 403 428 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133046
AA Change: V149A
SMART Domains Protein: ENSMUSP00000119461
Gene: ENSMUSG00000066568
AA Change: V149A

DomainStartEndE-ValueType
LSM14 1 62 1.33e-12 SMART
low complexity region 93 104 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155256
AA Change: V185A
SMART Domains Protein: ENSMUSP00000118766
Gene: ENSMUSG00000066568
AA Change: V185A

DomainStartEndE-ValueType
LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
Pfam:FDF 230 287 7.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205455
Predicted Effect unknown
Transcript: ENSMUST00000205519
AA Change: V134A
Predicted Effect probably benign
Transcript: ENSMUST00000206388
Predicted Effect probably benign
Transcript: ENSMUST00000206830
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Lsm14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lsm14a APN 7 34389355 intron probably benign
IGL02259:Lsm14a APN 7 34371133 missense probably damaging 1.00
IGL02940:Lsm14a APN 7 34371171 nonsense probably null
baluchistan UTSW 7 34353401 nonsense probably null
beast UTSW 7 34375374 missense probably damaging 1.00
R0234:Lsm14a UTSW 7 34365617 missense probably damaging 1.00
R0234:Lsm14a UTSW 7 34365617 missense probably damaging 1.00
R0826:Lsm14a UTSW 7 34371045 splice site probably benign
R1344:Lsm14a UTSW 7 34353557 missense probably damaging 1.00
R1641:Lsm14a UTSW 7 34351374 missense probably damaging 0.99
R1667:Lsm14a UTSW 7 34365654 missense possibly damaging 0.93
R2135:Lsm14a UTSW 7 34371184 missense probably damaging 1.00
R2331:Lsm14a UTSW 7 34357490 missense probably benign
R3709:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R3710:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R4304:Lsm14a UTSW 7 34357433 critical splice donor site probably null
R4998:Lsm14a UTSW 7 34375374 missense probably damaging 1.00
R5304:Lsm14a UTSW 7 34353729 missense possibly damaging 0.58
R5383:Lsm14a UTSW 7 34389364 missense possibly damaging 0.48
R5639:Lsm14a UTSW 7 34353510 missense probably damaging 1.00
R7443:Lsm14a UTSW 7 34353838 missense probably benign
R7559:Lsm14a UTSW 7 34353401 nonsense probably null
R7812:Lsm14a UTSW 7 34388876 intron probably benign
R8115:Lsm14a UTSW 7 34375237 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGCATTCAGATCCAGGTAGC -3'
(R):5'- GCTAGCAGGTTGAAGCTGAAC -3'

Sequencing Primer
(F):5'- CATTCAGATCCAGGTAGCTGCTG -3'
(R):5'- TGCAGGTGTTCTCATCTC -3'
Posted On2018-04-27