Incidental Mutation 'R6370:Nosip'
List |< first << previous [record 29 of 57] next >> last >|
ID513472
Institutional Source Beutler Lab
Gene Symbol Nosip
Ensembl Gene ENSMUSG00000003421
Gene Namenitric oxide synthase interacting protein
Synonyms2310061K06Rik, CGI-25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6370 (G1)
Quality Score124.008
Status Validated
Chromosome7
Chromosomal Location45062429-45078210 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 45076740 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003513] [ENSMUST00000107829] [ENSMUST00000210088] [ENSMUST00000210520] [ENSMUST00000211465]
Predicted Effect probably null
Transcript: ENSMUST00000003513
SMART Domains Protein: ENSMUSP00000003513
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
Pfam:zf-NOSIP 4 78 1.2e-55 PFAM
coiled coil region 83 108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107829
SMART Domains Protein: ENSMUSP00000103460
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
SCOP:d1rmd_2 31 79 2e-4 SMART
Blast:RING 46 226 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209901
Predicted Effect probably benign
Transcript: ENSMUST00000210088
Predicted Effect probably benign
Transcript: ENSMUST00000210520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210998
Predicted Effect probably benign
Transcript: ENSMUST00000211465
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Nosip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Nosip APN 7 45076859 missense probably damaging 1.00
IGL02245:Nosip APN 7 45074042 missense probably benign 0.13
IGL02385:Nosip APN 7 45076732 missense possibly damaging 0.90
IGL02676:Nosip APN 7 45077328 missense probably damaging 1.00
R0295:Nosip UTSW 7 45076916 missense probably damaging 1.00
R1599:Nosip UTSW 7 45074006 missense probably benign 0.02
R1812:Nosip UTSW 7 45076574 missense probably damaging 0.99
R1843:Nosip UTSW 7 45077309 splice site probably null
R2018:Nosip UTSW 7 45076609 missense probably benign
R2359:Nosip UTSW 7 45074026 missense possibly damaging 0.82
R4857:Nosip UTSW 7 45076678 missense probably benign 0.06
R6072:Nosip UTSW 7 45076648 missense possibly damaging 0.67
R7973:Nosip UTSW 7 45077360 missense possibly damaging 0.93
X0026:Nosip UTSW 7 45076397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATTCCCTCACTAACGC -3'
(R):5'- AGTTTGCAGTGCAGGCTAGG -3'

Sequencing Primer
(F):5'- AGGGCCCAATGTCCAGGATTC -3'
(R):5'- GCTGCAGCACGATGATGTC -3'
Posted On2018-04-27