Incidental Mutation 'R6370:Dixdc1'
ID513481
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene NameDIX domain containing 1
Synonyms4930563F16Rik, Ccd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6370 (G1)
Quality Score129.008
Status Validated
Chromosome9
Chromosomal Location50662752-50739517 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 50682223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117646] [ENSMUST00000120622] [ENSMUST00000121634]
Predicted Effect probably null
Transcript: ENSMUST00000034566
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117646
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119449
Predicted Effect probably null
Transcript: ENSMUST00000120622
SMART Domains Protein: ENSMUSP00000113934
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
coiled coil region 34 66 N/A INTRINSIC
coiled coil region 87 220 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121634
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50667733 missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50706134 missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50695503 missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50703258 nonsense probably null
IGL02074:Dixdc1 APN 9 50702017 missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50682631 splice site probably benign
R0230:Dixdc1 UTSW 9 50695507 missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50693674 missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50684853 missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50703246 missense probably benign 0.02
R1083:Dixdc1 UTSW 9 50676993 intron probably benign
R1672:Dixdc1 UTSW 9 50689864 missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50682550 missense probably benign
R2213:Dixdc1 UTSW 9 50701945 missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50683872 critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R2940:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R3081:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R4982:Dixdc1 UTSW 9 50682602 missense possibly damaging 0.89
R5250:Dixdc1 UTSW 9 50683735 missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50669480 missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50698588 intron probably benign
R6228:Dixdc1 UTSW 9 50703356 splice site probably null
R6346:Dixdc1 UTSW 9 50683953 missense probably damaging 1.00
R7036:Dixdc1 UTSW 9 50682564 missense probably benign 0.03
R7074:Dixdc1 UTSW 9 50689914 missense possibly damaging 0.83
R7361:Dixdc1 UTSW 9 50688653 missense probably damaging 0.99
R7734:Dixdc1 UTSW 9 50701968 missense probably damaging 1.00
R8292:Dixdc1 UTSW 9 50710689 missense probably benign 0.03
R8318:Dixdc1 UTSW 9 50684409 critical splice acceptor site probably null
R8353:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8453:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8462:Dixdc1 UTSW 9 50710779 nonsense probably null
R8810:Dixdc1 UTSW 9 50701965 missense probably damaging 1.00
RF016:Dixdc1 UTSW 9 50693641 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCACGGTGTTACCTTCC -3'
(R):5'- CACATGTGAGGCATTTAGTATCC -3'

Sequencing Primer
(F):5'- ATCACGGTGTTACCTTCCTTTCTTG -3'
(R):5'- CAGAGAACTCAAGCCTCT -3'
Posted On2018-04-27