Incidental Mutation 'R6370:Ccar1'
ID 513485
Institutional Source Beutler Lab
Gene Symbol Ccar1
Ensembl Gene ENSMUSG00000020074
Gene Name cell division cycle and apoptosis regulator 1
Synonyms 9430036H15Rik, 2610511G16Rik, Carp1
MMRRC Submission 044520-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 62579707-62628065 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 62600308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 541 (R541H)
Ref Sequence ENSEMBL: ENSMUSP00000151895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020268] [ENSMUST00000219527]
AlphaFold Q8CH18
Predicted Effect probably damaging
Transcript: ENSMUST00000020268
AA Change: R541H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020268
Gene: ENSMUSG00000020074
AA Change: R541H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 62 106 N/A INTRINSIC
Pfam:S1-like 144 201 1.7e-34 PFAM
low complexity region 236 254 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 358 N/A INTRINSIC
DBC1 475 606 4.46e-90 SMART
SAP 633 667 5.25e-9 SMART
Blast:HDc 753 784 1e-7 BLAST
coiled coil region 792 819 N/A INTRINSIC
low complexity region 871 895 N/A INTRINSIC
SCOP:d1hqva_ 898 964 5e-3 SMART
Blast:HDc 921 979 5e-17 BLAST
coiled coil region 1029 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219441
Predicted Effect probably damaging
Transcript: ENSMUST00000219527
AA Change: R541H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
Allele List at MGI

All alleles(45) : Targeted, other(4) Gene trapped(41)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,717,024 (GRCm39) V67A probably damaging Het
Atic T A 1: 71,617,819 (GRCm39) F590I probably damaging Het
Atxn10 T C 15: 85,277,586 (GRCm39) F351S probably damaging Het
Bcl2l13 A G 6: 120,842,583 (GRCm39) N92S probably benign Het
Carm1 G T 9: 21,498,815 (GRCm39) A518S probably benign Het
Cfhr2 A T 1: 139,750,065 (GRCm39) L96Q probably damaging Het
Chrnb4 A G 9: 54,942,143 (GRCm39) L377S probably benign Het
Clcn3 A G 8: 61,376,058 (GRCm39) Y639H probably damaging Het
Cngb1 C T 8: 95,991,050 (GRCm39) M717I probably benign Het
Ctcf T C 8: 106,390,852 (GRCm39) M153T probably benign Het
Cyp2b19 T C 7: 26,462,783 (GRCm39) S222P probably benign Het
Dixdc1 A T 9: 50,593,523 (GRCm39) probably null Het
Entpd2 G A 2: 25,287,429 (GRCm39) G47S probably damaging Het
Erbb3 A G 10: 128,405,943 (GRCm39) M1158T possibly damaging Het
Faah T C 4: 115,860,253 (GRCm39) D333G probably damaging Het
Foxred2 T A 15: 77,827,506 (GRCm39) T618S probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpx5 A T 13: 21,472,872 (GRCm39) probably null Het
Gtdc1 A G 2: 44,646,334 (GRCm39) V98A probably damaging Het
Hal T C 10: 93,333,368 (GRCm39) I312T probably damaging Het
Krtap21-1 T C 16: 89,200,519 (GRCm39) Y41C unknown Het
Larp6 A G 9: 60,644,646 (GRCm39) E262G probably damaging Het
Lrrn1 A G 6: 107,546,185 (GRCm39) Y661C probably damaging Het
Lsm14a A G 7: 34,056,906 (GRCm39) V244A probably benign Het
Mfrp T C 9: 44,017,558 (GRCm39) C517R probably damaging Het
Mtarc1 T C 1: 184,527,689 (GRCm39) D257G probably damaging Het
Ncoa3 T C 2: 165,907,825 (GRCm39) S1145P probably benign Het
Nosip G T 7: 44,726,164 (GRCm39) probably null Het
Or4c100 T A 2: 88,329,712 (GRCm39) C94* probably null Het
Or51f2 A T 7: 102,526,377 (GRCm39) T17S probably benign Het
Or52n1 T C 7: 104,383,124 (GRCm39) K149R probably benign Het
Phykpl T C 11: 51,477,543 (GRCm39) S112P probably damaging Het
Pik3cb A T 9: 98,922,987 (GRCm39) I1015K probably damaging Het
Pomt2 A G 12: 87,155,973 (GRCm39) W818R probably damaging Het
Ptpn21 A T 12: 98,655,293 (GRCm39) M558K possibly damaging Het
Rnf213 T A 11: 119,367,904 (GRCm39) N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Rxrg T C 1: 167,462,006 (GRCm39) V227A probably damaging Het
Satb1 A T 17: 52,089,825 (GRCm39) S341T possibly damaging Het
Skint5 T G 4: 113,471,307 (GRCm39) Q983P unknown Het
Slc6a18 G A 13: 73,816,278 (GRCm39) T367I probably benign Het
Slc7a1 A G 5: 148,277,483 (GRCm39) L344P probably damaging Het
Slc7a6 T A 8: 106,922,069 (GRCm39) F399I probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sugt1 T C 14: 79,847,774 (GRCm39) V208A probably benign Het
Syt3 A G 7: 44,045,107 (GRCm39) K480E probably damaging Het
Thop1 C T 10: 80,913,817 (GRCm39) T186I probably benign Het
Trim55 G A 3: 19,745,650 (GRCm39) E509K possibly damaging Het
Upf2 A G 2: 5,980,821 (GRCm39) N469S unknown Het
Usp24 G T 4: 106,237,718 (GRCm39) K1125N probably null Het
Usp5 A T 6: 124,797,391 (GRCm39) D494E probably benign Het
Vmn2r51 T C 7: 9,832,143 (GRCm39) K481R probably damaging Het
Vps16 C A 2: 130,285,304 (GRCm39) A787D probably damaging Het
Washc4 C T 10: 83,407,226 (GRCm39) H488Y possibly damaging Het
Wdfy4 C A 14: 32,790,807 (GRCm39) A2053S probably benign Het
Zfp74 A T 7: 29,631,835 (GRCm39) D136E probably damaging Het
Other mutations in Ccar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Ccar1 APN 10 62,589,013 (GRCm39) missense unknown
IGL01291:Ccar1 APN 10 62,592,428 (GRCm39) missense probably damaging 1.00
IGL01364:Ccar1 APN 10 62,612,653 (GRCm39) splice site probably null
IGL01777:Ccar1 APN 10 62,616,356 (GRCm39) missense possibly damaging 0.71
IGL01958:Ccar1 APN 10 62,626,714 (GRCm39) missense possibly damaging 0.94
IGL03096:Ccar1 APN 10 62,600,112 (GRCm39) missense probably benign 0.20
Lonk UTSW 10 62,600,312 (GRCm39) missense probably damaging 1.00
1mM(1):Ccar1 UTSW 10 62,619,665 (GRCm39) missense probably benign 0.00
ANU05:Ccar1 UTSW 10 62,592,428 (GRCm39) missense probably damaging 1.00
R0440:Ccar1 UTSW 10 62,616,236 (GRCm39) missense possibly damaging 0.94
R1295:Ccar1 UTSW 10 62,619,661 (GRCm39) critical splice donor site probably null
R1573:Ccar1 UTSW 10 62,586,434 (GRCm39) missense unknown
R1585:Ccar1 UTSW 10 62,586,780 (GRCm39) missense unknown
R1633:Ccar1 UTSW 10 62,586,793 (GRCm39) missense unknown
R1840:Ccar1 UTSW 10 62,599,289 (GRCm39) missense probably damaging 0.98
R1854:Ccar1 UTSW 10 62,600,296 (GRCm39) missense probably damaging 1.00
R1905:Ccar1 UTSW 10 62,612,437 (GRCm39) missense possibly damaging 0.85
R2011:Ccar1 UTSW 10 62,612,473 (GRCm39) missense probably benign 0.03
R2041:Ccar1 UTSW 10 62,601,827 (GRCm39) missense probably damaging 1.00
R2202:Ccar1 UTSW 10 62,581,066 (GRCm39) missense unknown
R2327:Ccar1 UTSW 10 62,600,161 (GRCm39) missense probably damaging 1.00
R2932:Ccar1 UTSW 10 62,612,538 (GRCm39) missense probably benign 0.08
R3040:Ccar1 UTSW 10 62,592,273 (GRCm39) missense possibly damaging 0.83
R4647:Ccar1 UTSW 10 62,583,196 (GRCm39) nonsense probably null
R4829:Ccar1 UTSW 10 62,581,114 (GRCm39) missense unknown
R4887:Ccar1 UTSW 10 62,588,997 (GRCm39) missense unknown
R4888:Ccar1 UTSW 10 62,588,997 (GRCm39) missense unknown
R5000:Ccar1 UTSW 10 62,586,784 (GRCm39) missense unknown
R5207:Ccar1 UTSW 10 62,589,060 (GRCm39) missense unknown
R5214:Ccar1 UTSW 10 62,606,740 (GRCm39) missense probably damaging 1.00
R5644:Ccar1 UTSW 10 62,607,757 (GRCm39) missense probably benign 0.16
R6035:Ccar1 UTSW 10 62,587,564 (GRCm39) missense unknown
R6035:Ccar1 UTSW 10 62,587,564 (GRCm39) missense unknown
R6063:Ccar1 UTSW 10 62,612,496 (GRCm39) missense possibly damaging 0.70
R6330:Ccar1 UTSW 10 62,600,312 (GRCm39) missense probably damaging 1.00
R6828:Ccar1 UTSW 10 62,600,209 (GRCm39) missense probably damaging 0.98
R6943:Ccar1 UTSW 10 62,582,715 (GRCm39) missense unknown
R8054:Ccar1 UTSW 10 62,583,215 (GRCm39) missense unknown
R8089:Ccar1 UTSW 10 62,626,770 (GRCm39) start codon destroyed probably null 0.33
R8202:Ccar1 UTSW 10 62,607,768 (GRCm39) missense possibly damaging 0.94
R8544:Ccar1 UTSW 10 62,586,358 (GRCm39) missense unknown
R8730:Ccar1 UTSW 10 62,601,191 (GRCm39) missense probably damaging 1.00
R9182:Ccar1 UTSW 10 62,621,347 (GRCm39) missense probably damaging 0.98
R9645:Ccar1 UTSW 10 62,602,369 (GRCm39) missense probably benign 0.09
V8831:Ccar1 UTSW 10 62,583,185 (GRCm39) missense unknown
X0017:Ccar1 UTSW 10 62,601,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTAGCGTTCAGTGCCTG -3'
(R):5'- TGGGTAGCTCTGTAAACATATCAG -3'

Sequencing Primer
(F):5'- TGCGTTCACCCTGAAGC -3'
(R):5'- CCAACCTCAAGTTCTTGC -3'
Posted On 2018-04-27