Incidental Mutation 'R6370:Hal'
ID513488
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93497506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 312 (I312T)
Ref Sequence ENSEMBL: ENSMUSP00000123336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000129421]
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129421
AA Change: I312T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017
AA Change: I312T

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152883
Meta Mutation Damage Score 0.7651 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1357:Hal UTSW 10 93500623 missense probably damaging 0.96
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2048:Hal UTSW 10 93491140 missense probably damaging 0.98
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R3948:Hal UTSW 10 93489907 missense possibly damaging 0.94
R4394:Hal UTSW 10 93496559 intron probably benign
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5018:Hal UTSW 10 93507551 critical splice donor site probably null
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
R8262:Hal UTSW 10 93492507 missense probably damaging 1.00
Z1176:Hal UTSW 10 93489893 missense probably benign 0.00
Z1177:Hal UTSW 10 93489335 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATCAAGCTCGTGAACCCG -3'
(R):5'- GGCAGTTCTGGATCTTCTCG -3'

Sequencing Primer
(F):5'- GCAGGATCGCCCCACAC -3'
(R):5'- TCCACCTCTGTGCCTAAAAATG -3'
Posted On2018-04-27