Incidental Mutation 'R6370:Erbb3'
List |< first << previous [record 15 of 57] next >> last >|
ID513489
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128570074 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1158 (M1158T)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000082059] [ENSMUST00000131728]
Predicted Effect probably benign
Transcript: ENSMUST00000026425
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000082059
AA Change: M1158T

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: M1158T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCGGGAAGAGGATGTAC -3'
(R):5'- ACGTCAGAGTCATCAGAGGG -3'

Sequencing Primer
(F):5'- GATGTACCTATGGTTGAGAGAAACTC -3'
(R):5'- TCATCAGAGGGCCATGTGAC -3'
Posted On2018-04-27