Incidental Mutation 'R6370:Phykpl'
List |< first << previous [record 33 of 57] next >> last >|
ID513490
Institutional Source Beutler Lab
Gene Symbol Phykpl
Ensembl Gene ENSMUSG00000020359
Gene Name5-phosphohydroxy-L-lysine phospholyase
SynonymsAgxt2l2, 2900006B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51584757-51604489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51586716 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000098808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020625] [ENSMUST00000101250] [ENSMUST00000102765] [ENSMUST00000167797]
Predicted Effect probably damaging
Transcript: ENSMUST00000020625
AA Change: S112P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020625
Gene: ENSMUSG00000020359
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 27 433 2.1e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101250
AA Change: S112P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098808
Gene: ENSMUSG00000020359
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 212 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102765
SMART Domains Protein: ENSMUSP00000099826
Gene: ENSMUSG00000063564

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:Collagen 107 162 3.7e-10 PFAM
Pfam:Collagen 140 207 1.3e-9 PFAM
low complexity region 212 237 N/A INTRINSIC
Pfam:Collagen 239 299 1.8e-11 PFAM
Pfam:Collagen 309 367 1.8e-10 PFAM
Pfam:Collagen 331 390 6.6e-11 PFAM
Pfam:Collagen 402 463 2.4e-11 PFAM
Pfam:Collagen 455 523 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164864
Predicted Effect probably damaging
Transcript: ENSMUST00000167797
AA Change: S112P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132190
Gene: ENSMUSG00000020359
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Aminotran_3 33 373 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169823
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: This gene overlaps in a tail-to-tail orientation the gene encoding heterogeneous nuclear ribonucleoprotein A/B. The terminal exon of this gene is interspersed with exons of heterogeneous nuclear ribonucleoprotein A/B. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Phykpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Phykpl APN 11 51599456 splice site probably benign
IGL01809:Phykpl APN 11 51599524 missense probably benign 0.09
IGL02636:Phykpl APN 11 51598713 missense probably damaging 1.00
IGL02668:Phykpl APN 11 51593687 critical splice donor site probably null
R0114:Phykpl UTSW 11 51586653 missense probably benign 0.00
R0308:Phykpl UTSW 11 51593596 splice site probably benign
R0332:Phykpl UTSW 11 51586675 missense probably benign 0.30
R0831:Phykpl UTSW 11 51585539 nonsense probably null
R3434:Phykpl UTSW 11 51598655 missense probably benign
R4272:Phykpl UTSW 11 51585528 missense probably damaging 1.00
R4539:Phykpl UTSW 11 51594088 missense probably damaging 1.00
R4618:Phykpl UTSW 11 51592229 missense probably damaging 1.00
R4633:Phykpl UTSW 11 51593608 missense probably damaging 1.00
R4816:Phykpl UTSW 11 51592953 missense probably benign
R4823:Phykpl UTSW 11 51586593 missense probably damaging 0.99
R5415:Phykpl UTSW 11 51585515 missense probably benign 0.00
R5920:Phykpl UTSW 11 51602795 missense probably benign
R6611:Phykpl UTSW 11 51598354 missense probably damaging 1.00
R6617:Phykpl UTSW 11 51593954 missense probably damaging 1.00
R7319:Phykpl UTSW 11 51598703 missense probably benign 0.20
R7340:Phykpl UTSW 11 51599543 missense probably damaging 1.00
R7499:Phykpl UTSW 11 51591458 missense probably damaging 1.00
R7947:Phykpl UTSW 11 51586581 missense probably damaging 0.98
R8146:Phykpl UTSW 11 51585581 missense probably damaging 1.00
R8353:Phykpl UTSW 11 51598294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGCCACTTGATGCAGATG -3'
(R):5'- CCAATGTGCCTAGAAGGGAG -3'

Sequencing Primer
(F):5'- AGATGCCCCTCTTGCAGTTGG -3'
(R):5'- CGGTGGTGTCCTCTACAAAG -3'
Posted On2018-04-27