Mutagenetix > Incidental Mutation

Incidental Mutation 'R6370:Rnf213'

513491

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

044520-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6370 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119283926-119378244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119367904 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 4647 (N4647K)

Ref Sequence

ENSEMBL: ENSMUSP00000091429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: N4647K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: N4647K

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: N4646K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: N4646K

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172235

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

95% (54/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb6	A	G	2: 30,717,024 (GRCm39)	V67A	probably damaging	Het
Atic	T	A	1: 71,617,819 (GRCm39)	F590I	probably damaging	Het
Atxn10	T	C	15: 85,277,586 (GRCm39)	F351S	probably damaging	Het
Bcl2l13	A	G	6: 120,842,583 (GRCm39)	N92S	probably benign	Het
Carm1	G	T	9: 21,498,815 (GRCm39)	A518S	probably benign	Het
Ccar1	C	T	10: 62,600,308 (GRCm39)	R541H	probably damaging	Het
Cfhr2	A	T	1: 139,750,065 (GRCm39)	L96Q	probably damaging	Het
Chrnb4	A	G	9: 54,942,143 (GRCm39)	L377S	probably benign	Het
Clcn3	A	G	8: 61,376,058 (GRCm39)	Y639H	probably damaging	Het
Cngb1	C	T	8: 95,991,050 (GRCm39)	M717I	probably benign	Het
Ctcf	T	C	8: 106,390,852 (GRCm39)	M153T	probably benign	Het
Cyp2b19	T	C	7: 26,462,783 (GRCm39)	S222P	probably benign	Het
Dixdc1	A	T	9: 50,593,523 (GRCm39)		probably null	Het
Entpd2	G	A	2: 25,287,429 (GRCm39)	G47S	probably damaging	Het
Erbb3	A	G	10: 128,405,943 (GRCm39)	M1158T	possibly damaging	Het
Faah	T	C	4: 115,860,253 (GRCm39)	D333G	probably damaging	Het
Foxred2	T	A	15: 77,827,506 (GRCm39)	T618S	probably benign	Het
Gm2381	G	A	7: 42,470,010 (GRCm39)	A38V	probably benign	Het
Gpx5	A	T	13: 21,472,872 (GRCm39)		probably null	Het
Gtdc1	A	G	2: 44,646,334 (GRCm39)	V98A	probably damaging	Het
Hal	T	C	10: 93,333,368 (GRCm39)	I312T	probably damaging	Het
Krtap21-1	T	C	16: 89,200,519 (GRCm39)	Y41C	unknown	Het
Larp6	A	G	9: 60,644,646 (GRCm39)	E262G	probably damaging	Het
Lrrn1	A	G	6: 107,546,185 (GRCm39)	Y661C	probably damaging	Het
Lsm14a	A	G	7: 34,056,906 (GRCm39)	V244A	probably benign	Het
Mfrp	T	C	9: 44,017,558 (GRCm39)	C517R	probably damaging	Het
Mtarc1	T	C	1: 184,527,689 (GRCm39)	D257G	probably damaging	Het
Ncoa3	T	C	2: 165,907,825 (GRCm39)	S1145P	probably benign	Het
Nosip	G	T	7: 44,726,164 (GRCm39)		probably null	Het
Or4c100	T	A	2: 88,329,712 (GRCm39)	C94*	probably null	Het
Or51f2	A	T	7: 102,526,377 (GRCm39)	T17S	probably benign	Het
Or52n1	T	C	7: 104,383,124 (GRCm39)	K149R	probably benign	Het
Phykpl	T	C	11: 51,477,543 (GRCm39)	S112P	probably damaging	Het
Pik3cb	A	T	9: 98,922,987 (GRCm39)	I1015K	probably damaging	Het
Pomt2	A	G	12: 87,155,973 (GRCm39)	W818R	probably damaging	Het
Ptpn21	A	T	12: 98,655,293 (GRCm39)	M558K	possibly damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,229,114 (GRCm39)		probably benign	Homo
Rxrg	T	C	1: 167,462,006 (GRCm39)	V227A	probably damaging	Het
Satb1	A	T	17: 52,089,825 (GRCm39)	S341T	possibly damaging	Het
Skint5	T	G	4: 113,471,307 (GRCm39)	Q983P	unknown	Het
Slc6a18	G	A	13: 73,816,278 (GRCm39)	T367I	probably benign	Het
Slc7a1	A	G	5: 148,277,483 (GRCm39)	L344P	probably damaging	Het
Slc7a6	T	A	8: 106,922,069 (GRCm39)	F399I	probably benign	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Sugt1	T	C	14: 79,847,774 (GRCm39)	V208A	probably benign	Het
Syt3	A	G	7: 44,045,107 (GRCm39)	K480E	probably damaging	Het
Thop1	C	T	10: 80,913,817 (GRCm39)	T186I	probably benign	Het
Trim55	G	A	3: 19,745,650 (GRCm39)	E509K	possibly damaging	Het
Upf2	A	G	2: 5,980,821 (GRCm39)	N469S	unknown	Het
Usp24	G	T	4: 106,237,718 (GRCm39)	K1125N	probably null	Het
Usp5	A	T	6: 124,797,391 (GRCm39)	D494E	probably benign	Het
Vmn2r51	T	C	7: 9,832,143 (GRCm39)	K481R	probably damaging	Het
Vps16	C	A	2: 130,285,304 (GRCm39)	A787D	probably damaging	Het
Washc4	C	T	10: 83,407,226 (GRCm39)	H488Y	possibly damaging	Het
Wdfy4	C	A	14: 32,790,807 (GRCm39)	A2053S	probably benign	Het
Zfp74	A	T	7: 29,631,835 (GRCm39)	D136E	probably damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,340,169 (GRCm39)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,331,669 (GRCm39)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,338,063 (GRCm39)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,373,944 (GRCm39)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,334,126 (GRCm39)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,340,702 (GRCm39)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,327,178 (GRCm39)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,332,133 (GRCm39)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,333,092 (GRCm39)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,333,841 (GRCm39)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,307,283 (GRCm39)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,334,094 (GRCm39)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,309,135 (GRCm39)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,336,499 (GRCm39)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,331,476 (GRCm39)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,371,733 (GRCm39)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,354,162 (GRCm39)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,327,628 (GRCm39)	missense	probably benign
IGL02588:Rnf213	APN	11	119,307,362 (GRCm39)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,331,615 (GRCm39)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,325,892 (GRCm39)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,318,336 (GRCm39)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,370,767 (GRCm39)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,336,452 (GRCm39)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,331,913 (GRCm39)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,355,833 (GRCm39)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,364,998 (GRCm39)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,333,830 (GRCm39)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,312,294 (GRCm39)	missense	probably benign	0.34
attrition	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
defame	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
Derogate	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
dinky	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,325,568 (GRCm39)	missense
Impugn	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,316,895 (GRCm39)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
PIT4585001:Rnf213	UTSW	11	119,349,218 (GRCm39)	missense
R0008:Rnf213	UTSW	11	119,355,878 (GRCm39)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,332,432 (GRCm39)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,293,401 (GRCm39)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,305,413 (GRCm39)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,307,322 (GRCm39)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,370,426 (GRCm39)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,305,347 (GRCm39)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,328,931 (GRCm39)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,316,937 (GRCm39)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,338,083 (GRCm39)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,316,838 (GRCm39)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,333,946 (GRCm39)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,355,908 (GRCm39)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,334,106 (GRCm39)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,322,543 (GRCm39)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,332,660 (GRCm39)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,331,976 (GRCm39)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,331,894 (GRCm39)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,364,306 (GRCm39)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,313,921 (GRCm39)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,321,312 (GRCm39)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,305,396 (GRCm39)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,307,389 (GRCm39)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,343,407 (GRCm39)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,376,824 (GRCm39)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,368,055 (GRCm39)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,326,809 (GRCm39)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,327,003 (GRCm39)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,326,831 (GRCm39)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,333,226 (GRCm39)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,328,576 (GRCm39)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,371,715 (GRCm39)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,332,714 (GRCm39)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,333,533 (GRCm39)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,332,665 (GRCm39)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,305,352 (GRCm39)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,327,437 (GRCm39)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,354,171 (GRCm39)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,333,405 (GRCm39)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,328,498 (GRCm39)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,331,047 (GRCm39)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,332,009 (GRCm39)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,340,955 (GRCm39)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,307,274 (GRCm39)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,322,511 (GRCm39)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,371,721 (GRCm39)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,331,933 (GRCm39)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,326,848 (GRCm39)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,352,744 (GRCm39)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,358,128 (GRCm39)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,333,489 (GRCm39)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,318,839 (GRCm39)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,341,027 (GRCm39)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,334,516 (GRCm39)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,306,019 (GRCm39)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,305,896 (GRCm39)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,350,835 (GRCm39)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,327,254 (GRCm39)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,305,430 (GRCm39)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,334,021 (GRCm39)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,350,764 (GRCm39)	splice site	probably null
R2698:Rnf213	UTSW	11	119,300,970 (GRCm39)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,359,718 (GRCm39)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,332,802 (GRCm39)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,370,384 (GRCm39)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R4014:Rnf213	UTSW	11	119,336,555 (GRCm39)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,373,274 (GRCm39)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,373,832 (GRCm39)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,300,308 (GRCm39)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,332,069 (GRCm39)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,374,790 (GRCm39)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,370,496 (GRCm39)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,328,521 (GRCm39)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,331,951 (GRCm39)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,331,175 (GRCm39)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,336,571 (GRCm39)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,307,455 (GRCm39)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,333,589 (GRCm39)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,372,066 (GRCm39)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,318,983 (GRCm39)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,327,590 (GRCm39)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,301,633 (GRCm39)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,349,692 (GRCm39)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,331,642 (GRCm39)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,331,634 (GRCm39)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,299,846 (GRCm39)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,305,902 (GRCm39)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,324,325 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,731 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,455 (GRCm39)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,349,611 (GRCm39)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,325,512 (GRCm39)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,374,720 (GRCm39)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,327,121 (GRCm39)	missense	probably benign
R5861:Rnf213	UTSW	11	119,364,203 (GRCm39)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,312,195 (GRCm39)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,333,905 (GRCm39)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,376,836 (GRCm39)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,332,927 (GRCm39)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,307,385 (GRCm39)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,302,339 (GRCm39)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,302,296 (GRCm39)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,332,854 (GRCm39)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,326,825 (GRCm39)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,349,254 (GRCm39)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,305,374 (GRCm39)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,354,192 (GRCm39)	missense	probably damaging	1.00
R6456:Rnf213	UTSW	11	119,350,792 (GRCm39)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,343,513 (GRCm39)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,327,106 (GRCm39)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,370,746 (GRCm39)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,333,097 (GRCm39)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,353,111 (GRCm39)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,339,664 (GRCm39)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,340,692 (GRCm39)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,370,481 (GRCm39)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,328,430 (GRCm39)	splice site	probably null
R7170:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7185:Rnf213	UTSW	11	119,315,024 (GRCm39)	missense
R7239:Rnf213	UTSW	11	119,349,614 (GRCm39)	missense
R7258:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7259:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7260:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7273:Rnf213	UTSW	11	119,322,582 (GRCm39)	splice site	probably null
R7282:Rnf213	UTSW	11	119,328,818 (GRCm39)	missense
R7311:Rnf213	UTSW	11	119,307,373 (GRCm39)	missense
R7352:Rnf213	UTSW	11	119,334,405 (GRCm39)	missense
R7369:Rnf213	UTSW	11	119,321,294 (GRCm39)	missense
R7410:Rnf213	UTSW	11	119,325,877 (GRCm39)	missense
R7448:Rnf213	UTSW	11	119,372,117 (GRCm39)	missense
R7561:Rnf213	UTSW	11	119,332,545 (GRCm39)	missense
R7573:Rnf213	UTSW	11	119,349,310 (GRCm39)	missense
R7615:Rnf213	UTSW	11	119,358,123 (GRCm39)	missense
R7680:Rnf213	UTSW	11	119,370,382 (GRCm39)	missense
R7739:Rnf213	UTSW	11	119,301,687 (GRCm39)	missense
R7789:Rnf213	UTSW	11	119,361,045 (GRCm39)	splice site	probably null
R7806:Rnf213	UTSW	11	119,302,371 (GRCm39)	missense
R8031:Rnf213	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,332,480 (GRCm39)	missense
R8053:Rnf213	UTSW	11	119,293,473 (GRCm39)	missense
R8284:Rnf213	UTSW	11	119,318,909 (GRCm39)	missense
R8301:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
R8325:Rnf213	UTSW	11	119,321,271 (GRCm39)	missense
R8332:Rnf213	UTSW	11	119,374,524 (GRCm39)	missense
R8443:Rnf213	UTSW	11	119,340,149 (GRCm39)	missense
R8518:Rnf213	UTSW	11	119,353,043 (GRCm39)	missense
R8531:Rnf213	UTSW	11	119,365,031 (GRCm39)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,349,563 (GRCm39)	missense
R8675:Rnf213	UTSW	11	119,346,984 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,332,038 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,308,955 (GRCm39)	missense
R8714:Rnf213	UTSW	11	119,359,720 (GRCm39)	missense
R8802:Rnf213	UTSW	11	119,352,928 (GRCm39)	missense
R8861:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense
R8886:Rnf213	UTSW	11	119,364,264 (GRCm39)	missense
R8893:Rnf213	UTSW	11	119,333,868 (GRCm39)	missense
R8937:Rnf213	UTSW	11	119,321,100 (GRCm39)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,305,250 (GRCm39)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,352,756 (GRCm39)	missense
R8983:Rnf213	UTSW	11	119,321,175 (GRCm39)	missense
R9043:Rnf213	UTSW	11	119,349,739 (GRCm39)	missense
R9081:Rnf213	UTSW	11	119,357,062 (GRCm39)	missense
R9132:Rnf213	UTSW	11	119,374,742 (GRCm39)	missense
R9135:Rnf213	UTSW	11	119,299,573 (GRCm39)	missense
R9146:Rnf213	UTSW	11	119,334,499 (GRCm39)	missense
R9156:Rnf213	UTSW	11	119,331,574 (GRCm39)	missense
R9183:Rnf213	UTSW	11	119,318,448 (GRCm39)	missense
R9234:Rnf213	UTSW	11	119,340,943 (GRCm39)	missense
R9275:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9278:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9296:Rnf213	UTSW	11	119,334,621 (GRCm39)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,332,975 (GRCm39)	missense
R9366:Rnf213	UTSW	11	119,327,057 (GRCm39)	missense
R9413:Rnf213	UTSW	11	119,357,059 (GRCm39)	missense
R9444:Rnf213	UTSW	11	119,325,623 (GRCm39)	missense
R9464:Rnf213	UTSW	11	119,354,406 (GRCm39)	missense
R9605:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R9649:Rnf213	UTSW	11	119,370,457 (GRCm39)	missense
R9651:Rnf213	UTSW	11	119,331,238 (GRCm39)	missense
R9664:Rnf213	UTSW	11	119,332,794 (GRCm39)	missense
R9696:Rnf213	UTSW	11	119,359,806 (GRCm39)	missense
R9710:Rnf213	UTSW	11	119,331,831 (GRCm39)	missense
R9797:Rnf213	UTSW	11	119,333,365 (GRCm39)	missense
S24628:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,332,650 (GRCm39)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,364,339 (GRCm39)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,331,289 (GRCm39)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,368,080 (GRCm39)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,373,824 (GRCm39)	missense
Z1176:Rnf213	UTSW	11	119,332,236 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- GCAGTGATTGTGGCATCTTAGC -3'
(R):5'- TTCTGGAGGAAGTGCCAGAG -3'

Sequencing Primer
(F):5'- AGCCCTGAATCCCCTGTATTCAG -3'
(R):5'- AGGACAGGCACCGTTTCCTTG -3'

Posted On

2018-04-27