Incidental Mutation 'R6370:Pomt2'
List |< first << previous [record 35 of 57] next >> last >|
ID513492
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87109199 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 818 (W818R)
Ref Sequence ENSEMBL: ENSMUSP00000035260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably damaging
Transcript: ENSMUST00000037788
AA Change: W818R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126
AA Change: W818R

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222634
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
PIT4366001:Pomt2 UTSW 12 87116529 critical splice donor site probably null
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4482:Pomt2 UTSW 12 87131830 missense probably benign 0.41
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R5790:Pomt2 UTSW 12 87127378 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6631:Pomt2 UTSW 12 87139643 critical splice donor site probably null
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
R7690:Pomt2 UTSW 12 87130367 missense probably damaging 1.00
R7864:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R8060:Pomt2 UTSW 12 87129006 missense probably damaging 1.00
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Z1177:Pomt2 UTSW 12 87111442 missense possibly damaging 0.74
Z1177:Pomt2 UTSW 12 87139681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGTGCTTCACAGGAAC -3'
(R):5'- CAGCACAGGGACTTAGAGTTAG -3'

Sequencing Primer
(F):5'- AGCAGTGCTGTAGGTCACG -3'
(R):5'- CACAGGGACTTAGAGTTAGAGCTCC -3'
Posted On2018-04-27