Incidental Mutation 'R6370:Sugt1'
ID513497
Institutional Source Beutler Lab
Gene Symbol Sugt1
Ensembl Gene ENSMUSG00000022024
Gene NameSGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
SynonymsSGT1, 2410174K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location79587691-79635196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79610334 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000052942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054908]
Predicted Effect probably benign
Transcript: ENSMUST00000054908
AA Change: V208A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052942
Gene: ENSMUSG00000022024
AA Change: V208A

DomainStartEndE-ValueType
Pfam:TPR_11 18 76 6.9e-14 PFAM
Pfam:TPR_9 24 53 7.1e-3 PFAM
Pfam:TPR_17 33 66 6.1e-7 PFAM
Pfam:TPR_1 45 78 1.2e-7 PFAM
Pfam:TPR_2 45 78 1.2e-6 PFAM
Pfam:TPR_8 45 78 2.3e-4 PFAM
Blast:TPR 80 112 1e-11 BLAST
Pfam:CS 143 219 5.9e-24 PFAM
Pfam:SGS 256 336 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228675
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved nuclear protein involved in kinetochore function and required for the G1/S and G2/M transitions. This protein interacts with heat shock protein 90. Alternative splicing results in multiple transcript variants. Pseudogenes for this gene have been defined on several different chromosomes. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null embryos die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Sugt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Sugt1 APN 14 79596790 missense probably benign 0.01
IGL02071:Sugt1 APN 14 79610283 nonsense probably null
IGL02417:Sugt1 APN 14 79610258 missense probably benign 0.00
IGL03205:Sugt1 APN 14 79596801 missense probably damaging 1.00
R0680:Sugt1 UTSW 14 79610311 missense possibly damaging 0.86
R1506:Sugt1 UTSW 14 79624925 missense probably benign 0.21
R1636:Sugt1 UTSW 14 79587982 missense probably benign
R1863:Sugt1 UTSW 14 79608994 missense probably damaging 1.00
R5253:Sugt1 UTSW 14 79602901 critical splice donor site probably null
R5870:Sugt1 UTSW 14 79609011 missense probably benign 0.11
R6657:Sugt1 UTSW 14 79607261 missense probably benign
R6967:Sugt1 UTSW 14 79597407 missense probably benign 0.25
R7429:Sugt1 UTSW 14 79619801 critical splice donor site probably null
R7430:Sugt1 UTSW 14 79619801 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATTCAAATGAGAGATGCCATGTG -3'
(R):5'- ACCTTTAACTCAGTGGTGTGTG -3'

Sequencing Primer
(F):5'- TTTGCCAAGCCAGACAGTCTG -3'
(R):5'- CAGTGGTGTGTGTCTTAAAAACAGC -3'
Posted On2018-04-27