Incidental Mutation 'R6370:Atxn10'
ID513500
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Nameataxin 10
SynonymsTEG-169, Sca10, E46, Tex169
MMRRC Submission
Accession Numbers

Genbank: NM_016843: MGI: 1859293

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85336245-85463212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85393385 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 351 (F351S)
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
Predicted Effect probably damaging
Transcript: ENSMUST00000163242
AA Change: F351S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541
AA Change: F351S

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85336465 start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85375422 splice site probably null
IGL01380:Atxn10 APN 15 85376695 nonsense probably null
IGL01408:Atxn10 APN 15 85376695 nonsense probably null
3-1:Atxn10 UTSW 15 85438094 splice site probably benign
R0190:Atxn10 UTSW 15 85336529 missense possibly damaging 0.84
R0319:Atxn10 UTSW 15 85365282 missense probably damaging 1.00
R1437:Atxn10 UTSW 15 85359474 missense possibly damaging 0.47
R1746:Atxn10 UTSW 15 85376663 missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85365312 missense probably benign 0.37
R3055:Atxn10 UTSW 15 85387005 missense probably benign 0.03
R4559:Atxn10 UTSW 15 85438120 missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85387143 missense probably benign 0.03
R4799:Atxn10 UTSW 15 85376708 splice site probably null
R4831:Atxn10 UTSW 15 85387059 missense probably benign 0.01
R5323:Atxn10 UTSW 15 85391743 missense probably benign 0.00
R5335:Atxn10 UTSW 15 85336584 splice site probably null
R5355:Atxn10 UTSW 15 85462314 missense probably damaging 1.00
R5768:Atxn10 UTSW 15 85393420 missense probably benign 0.01
R6260:Atxn10 UTSW 15 85462411 missense probably benign 0.38
R6277:Atxn10 UTSW 15 85391692 missense probably benign 0.05
R6645:Atxn10 UTSW 15 85376703 critical splice donor site probably null
R6957:Atxn10 UTSW 15 85336498 missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R7942:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R8031:Atxn10 UTSW 15 85393393 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGTGAGGATGAACTGATGC -3'
(R):5'- CCTTGCCCAGAGAGAAAATAGTC -3'

Sequencing Primer
(F):5'- ATGAACTGATGCCGCCAG -3'
(R):5'- GCCCAGAGAGAAAATAGTCTAAATTC -3'
Posted On2018-04-27