Incidental Mutation 'R6370:Satb1'
List |< first << previous [record 40 of 57] next >> last >|
ID513502
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Namespecial AT-rich sequence binding protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location51736187-51833290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51782797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 341 (S341T)
Ref Sequence ENSEMBL: ENSMUSP00000134957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129667
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133574
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140979
AA Change: S341T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144331
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152830
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169480
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176669
AA Change: S341T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: S341T

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr568 A T 7: 102,877,170 T17S probably benign Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 51805289 missense probably damaging 1.00
IGL01658:Satb1 APN 17 51775251 missense probably benign 0.33
IGL02070:Satb1 APN 17 51740067 missense probably damaging 0.98
IGL02212:Satb1 APN 17 51775291 missense possibly damaging 0.82
IGL02971:Satb1 APN 17 51742689 missense possibly damaging 0.62
R0049:Satb1 UTSW 17 51740346 missense probably benign 0.28
R0056:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0060:Satb1 UTSW 17 51740203 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0067:Satb1 UTSW 17 51804336 missense probably damaging 1.00
R0113:Satb1 UTSW 17 51782698 nonsense probably null
R0347:Satb1 UTSW 17 51739906 nonsense probably null
R0667:Satb1 UTSW 17 51782861 missense probably damaging 1.00
R1436:Satb1 UTSW 17 51804363 unclassified probably null
R1595:Satb1 UTSW 17 51782701 missense possibly damaging 0.82
R1686:Satb1 UTSW 17 51739999 missense probably benign 0.08
R1921:Satb1 UTSW 17 51742115 nonsense probably null
R1952:Satb1 UTSW 17 51740145 missense probably damaging 1.00
R2012:Satb1 UTSW 17 51782788 nonsense probably null
R2156:Satb1 UTSW 17 51740410 missense probably benign 0.02
R2180:Satb1 UTSW 17 51803496 missense probably damaging 0.96
R2959:Satb1 UTSW 17 51775303 missense possibly damaging 0.91
R3107:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3108:Satb1 UTSW 17 51782782 missense possibly damaging 0.95
R3814:Satb1 UTSW 17 51782907 missense probably damaging 0.98
R4109:Satb1 UTSW 17 51804350 missense probably damaging 0.99
R4727:Satb1 UTSW 17 51804347 missense probably damaging 1.00
R5209:Satb1 UTSW 17 51809207 missense probably benign 0.26
R5652:Satb1 UTSW 17 51742795 missense probably damaging 1.00
R5815:Satb1 UTSW 17 51782953 missense possibly damaging 0.92
R6141:Satb1 UTSW 17 51775376 missense possibly damaging 0.93
R7371:Satb1 UTSW 17 51782980 nonsense probably null
R7409:Satb1 UTSW 17 51809189 missense possibly damaging 0.90
R7471:Satb1 UTSW 17 51783001 missense probably damaging 0.96
R7568:Satb1 UTSW 17 51782724 missense possibly damaging 0.88
R7626:Satb1 UTSW 17 51767967 missense probably benign 0.25
R7749:Satb1 UTSW 17 51767933 missense possibly damaging 0.70
R7863:Satb1 UTSW 17 51805322 missense possibly damaging 0.91
R8339:Satb1 UTSW 17 51782949 missense probably damaging 0.97
Z1088:Satb1 UTSW 17 51782939 missense probably damaging 0.99
Z1088:Satb1 UTSW 17 51782952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACACAACTGACCTGAGTTCG -3'
(R):5'- TGTCCCAGGAAACACAGCTG -3'

Sequencing Primer
(F):5'- CTGACCTGAGTTCGGTTAAAAGCC -3'
(R):5'- TGAGCAGCCTCCATCCC -3'
Posted On2018-04-27