Incidental Mutation 'R6371:Nop58'
List |< first << previous [record 31 of 50] next >> last >|
ID513504
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene NameNOP58 ribonucleoprotein
SynonymsMSSP, SIK similar protein, Nol5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location59684971-59719044 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 59711312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000190265] [ENSMUST00000191142]
Predicted Effect unknown
Transcript: ENSMUST00000027174
AA Change: L437R
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020
AA Change: L437R

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect probably benign
Transcript: ENSMUST00000187837
Predicted Effect probably benign
Transcript: ENSMUST00000188390
Predicted Effect probably benign
Transcript: ENSMUST00000190265
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect silent
Transcript: ENSMUST00000191142
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59704083 missense probably damaging 0.98
R0584:Nop58 UTSW 1 59706760 missense probably benign 0.00
R1170:Nop58 UTSW 1 59704211 splice site probably benign
R1177:Nop58 UTSW 1 59700932 missense probably damaging 1.00
R1485:Nop58 UTSW 1 59698345 missense probably damaging 0.98
R1588:Nop58 UTSW 1 59702872 missense probably damaging 1.00
R4715:Nop58 UTSW 1 59696026 missense probably benign 0.00
R5611:Nop58 UTSW 1 59710513 unclassified probably benign
R5933:Nop58 UTSW 1 59704665 nonsense probably null
R5979:Nop58 UTSW 1 59702831 missense probably damaging 1.00
R6010:Nop58 UTSW 1 59700912 missense probably damaging 1.00
R6244:Nop58 UTSW 1 59702855 missense probably damaging 1.00
R7210:Nop58 UTSW 1 59710380 splice site probably null
R7337:Nop58 UTSW 1 59698440 missense probably benign 0.00
R7582:Nop58 UTSW 1 59700938 missense probably damaging 0.99
R7704:Nop58 UTSW 1 59705595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAGCTTGCTTTGTTGAC -3'
(R):5'- CATAGAAAGGGCTAAAGATTCTCTGC -3'

Sequencing Primer
(F):5'- GAAGCTTGCTTTGTTGACATTACAG -3'
(R):5'- GCTAGATATTCAACCTCCCT -3'
Posted On2018-04-27