Incidental Mutation 'R6371:Sgip1'
ID513511
Institutional Source Beutler Lab
Gene Symbol Sgip1
Ensembl Gene ENSMUSG00000028524
Gene NameSH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms3110007P09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144906; MGI: 1920344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location102741297-102973628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102966285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 721 (V721E)
Ref Sequence ENSEMBL: ENSMUSP00000102495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066824] [ENSMUST00000072481] [ENSMUST00000080728] [ENSMUST00000106882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066824
AA Change: V554E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063712
Gene: ENSMUSG00000028524
AA Change: V554E

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 391 658 5.9e-79 PFAM
Pfam:Adap_comp_sub 469 650 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072481
AA Change: V534E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072301
Gene: ENSMUSG00000028524
AA Change: V534E

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 371 638 5.5e-79 PFAM
Pfam:Adap_comp_sub 449 630 1.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080728
AA Change: V701E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079553
Gene: ENSMUSG00000028524
AA Change: V701E

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 538 805 9e-79 PFAM
Pfam:Adap_comp_sub 617 797 2.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106882
AA Change: V721E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102495
Gene: ENSMUSG00000028524
AA Change: V721E

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 558 825 1.7e-74 PFAM
Pfam:Adap_comp_sub 657 809 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149348
Predicted Effect unknown
Transcript: ENSMUST00000149547
AA Change: V469E
SMART Domains Protein: ENSMUSP00000122556
Gene: ENSMUSG00000028524
AA Change: V469E

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
low complexity region 207 224 N/A INTRINSIC
low complexity region 226 247 N/A INTRINSIC
Pfam:muHD 307 574 3.9e-75 PFAM
Pfam:Adap_comp_sub 404 558 3.2e-10 PFAM
Meta Mutation Damage Score 0.6734 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751] and Uezu et al., 2007 [PubMed 17626015]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Sgip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Sgip1 APN 4 102928921 splice site probably benign
IGL01348:Sgip1 APN 4 102915156 splice site probably null
IGL01446:Sgip1 APN 4 102928913 critical splice donor site probably null
IGL01937:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL01945:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL02249:Sgip1 APN 4 102911470 missense probably benign 0.40
IGL03232:Sgip1 APN 4 102915054 splice site probably benign
3-1:Sgip1 UTSW 4 102967663 missense probably damaging 1.00
PIT4378001:Sgip1 UTSW 4 102921083 missense unknown
R0309:Sgip1 UTSW 4 102915157 splice site probably benign
R0689:Sgip1 UTSW 4 102966252 missense probably damaging 1.00
R1563:Sgip1 UTSW 4 102966260 missense probably benign 0.38
R1715:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R1899:Sgip1 UTSW 4 102968337 critical splice donor site probably null
R2286:Sgip1 UTSW 4 102867647 missense possibly damaging 0.95
R2372:Sgip1 UTSW 4 102909791 critical splice donor site probably null
R3836:Sgip1 UTSW 4 102867700 splice site probably null
R4670:Sgip1 UTSW 4 102869754 missense probably damaging 1.00
R4697:Sgip1 UTSW 4 102934587 missense probably damaging 1.00
R4725:Sgip1 UTSW 4 102966222 missense probably damaging 1.00
R4892:Sgip1 UTSW 4 102966234 missense probably damaging 1.00
R5112:Sgip1 UTSW 4 102869769 missense probably damaging 1.00
R5236:Sgip1 UTSW 4 102927587 critical splice donor site probably null
R5285:Sgip1 UTSW 4 102921477 unclassified probably benign
R5323:Sgip1 UTSW 4 102966280 missense probably damaging 1.00
R5384:Sgip1 UTSW 4 102934566 missense possibly damaging 0.46
R5386:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R5682:Sgip1 UTSW 4 102967650 missense possibly damaging 0.88
R6226:Sgip1 UTSW 4 102966195 missense probably damaging 1.00
R6594:Sgip1 UTSW 4 102962479 missense probably damaging 0.98
R6656:Sgip1 UTSW 4 102905568 intron probably benign
R6800:Sgip1 UTSW 4 102921028 unclassified probably benign
R6855:Sgip1 UTSW 4 102962376 missense probably damaging 0.99
R6917:Sgip1 UTSW 4 102968191 missense probably damaging 1.00
R7340:Sgip1 UTSW 4 102921464 missense unknown
R7414:Sgip1 UTSW 4 102967624 nonsense probably null
R7612:Sgip1 UTSW 4 102869808 missense probably benign 0.28
R7936:Sgip1 UTSW 4 102928900 missense possibly damaging 0.66
R7944:Sgip1 UTSW 4 102915101 missense probably benign
R7976:Sgip1 UTSW 4 102900539 critical splice donor site probably null
R8508:Sgip1 UTSW 4 102915071 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGAGACTTACGCGTTCTCTC -3'
(R):5'- AGTTATCCGTTTCCACCCAAG -3'

Sequencing Primer
(F):5'- GAGACTTACGCGTTCTCTCTCCTG -3'
(R):5'- TGAGGTCTCTTCCCACAGG -3'
Posted On2018-04-27