Incidental Mutation 'R6371:Reln'
ID 513516
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 044521-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R6371 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 22089452-22549700 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22200511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1330 (M1330L)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: M1330L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: M1330L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161353
Predicted Effect probably benign
Transcript: ENSMUST00000161356
AA Change: M1330L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: M1330L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,894 (GRCm39) S237L probably damaging Het
Ank3 T G 10: 69,644,709 (GRCm39) L58V probably damaging Het
Arsb A T 13: 93,926,574 (GRCm39) I115F possibly damaging Het
Atad2b T C 12: 5,023,970 (GRCm39) Y32H probably damaging Het
Brd1 A C 15: 88,598,201 (GRCm39) M515R probably benign Het
Cbx7 A G 15: 79,803,023 (GRCm39) S30P possibly damaging Het
Cdk12 A G 11: 98,136,114 (GRCm39) T1123A unknown Het
Cep170b A G 12: 112,707,379 (GRCm39) D375G probably damaging Het
Clcn3 T C 8: 61,390,369 (GRCm39) K164E probably benign Het
Clip4 A C 17: 72,163,459 (GRCm39) K677T probably damaging Het
Clrn2 T C 5: 45,617,540 (GRCm39) I137T possibly damaging Het
Cntln T C 4: 84,802,816 (GRCm39) S39P probably damaging Het
Crocc2 T A 1: 93,143,353 (GRCm39) N1318K probably benign Het
Emc1 C T 4: 139,098,976 (GRCm39) Q820* probably null Het
Fbxl2 G A 9: 113,818,451 (GRCm39) T170I probably damaging Het
Fyb2 A G 4: 104,852,975 (GRCm39) T552A probably damaging Het
Garin5b A G 7: 4,762,358 (GRCm39) V257A probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Helz2 C T 2: 180,875,260 (GRCm39) E1745K probably damaging Het
Hspg2 T C 4: 137,269,006 (GRCm39) Y2213H probably damaging Het
Ifnar2 T C 16: 91,184,986 (GRCm39) Y24H possibly damaging Het
Inpp5d T A 1: 87,627,397 (GRCm39) L566Q probably damaging Het
Itgb2 C A 10: 77,384,431 (GRCm39) P184H probably damaging Het
Kcnb2 T A 1: 15,781,436 (GRCm39) D769E probably benign Het
Lrp1b A G 2: 40,741,666 (GRCm39) M3087T possibly damaging Het
Ltbp3 A G 19: 5,795,800 (GRCm39) probably null Het
Ms4a6b A G 19: 11,497,728 (GRCm39) E9G probably damaging Het
Nat3 G A 8: 67,976,831 (GRCm39) probably null Het
Ndufaf1 A T 2: 119,490,534 (GRCm39) D175E probably damaging Het
Nop58 T G 1: 59,750,471 (GRCm39) probably benign Het
Or10al6 A G 17: 38,083,326 (GRCm39) T261A probably benign Het
Or8s16 A G 15: 98,211,219 (GRCm39) Y71H possibly damaging Het
P3h4 C T 11: 100,302,575 (GRCm39) E354K probably benign Het
Plekhm2 T G 4: 141,356,843 (GRCm39) T787P possibly damaging Het
Ppia C T 11: 6,368,230 (GRCm39) T37I probably benign Het
Ric1 A G 19: 29,539,426 (GRCm39) E53G probably benign Het
Sgip1 T A 4: 102,823,482 (GRCm39) V721E probably damaging Het
Slc33a1 A T 3: 63,850,709 (GRCm39) D538E probably benign Het
Son T C 16: 91,471,629 (GRCm39) Het
Srebf1 A T 11: 60,094,341 (GRCm39) S591R probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Taok2 G A 7: 126,469,319 (GRCm39) R1170W probably damaging Het
Tsc2 A T 17: 24,845,688 (GRCm39) V210E probably benign Het
Ttc6 T A 12: 57,775,249 (GRCm39) N1648K possibly damaging Het
Vgll3 C T 16: 65,636,131 (GRCm39) P94L probably damaging Het
Vmn2r54 A T 7: 12,349,362 (GRCm39) V740E probably damaging Het
Yeats2 A G 16: 20,040,460 (GRCm39) E1127G possibly damaging Het
Zfp709 T A 8: 72,643,329 (GRCm39) Y252N probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,215,125 (GRCm39) missense probably damaging 1.00
IGL00433:Reln APN 5 22,250,007 (GRCm39) missense probably damaging 1.00
IGL00576:Reln APN 5 22,359,948 (GRCm39) missense probably benign 0.01
IGL00755:Reln APN 5 22,265,378 (GRCm39) missense probably damaging 0.98
IGL00777:Reln APN 5 22,223,848 (GRCm39) critical splice donor site probably null
IGL00900:Reln APN 5 22,185,115 (GRCm39) missense probably damaging 0.98
IGL01067:Reln APN 5 22,184,664 (GRCm39) missense probably damaging 1.00
IGL01104:Reln APN 5 22,191,965 (GRCm39) missense probably damaging 0.99
IGL01141:Reln APN 5 22,174,031 (GRCm39) missense probably damaging 1.00
IGL01141:Reln APN 5 22,124,067 (GRCm39) missense probably damaging 1.00
IGL01333:Reln APN 5 22,376,249 (GRCm39) missense probably damaging 0.99
IGL01341:Reln APN 5 22,174,077 (GRCm39) missense probably damaging 1.00
IGL01354:Reln APN 5 22,124,173 (GRCm39) nonsense probably null
IGL01361:Reln APN 5 22,124,019 (GRCm39) missense probably benign 0.06
IGL01446:Reln APN 5 22,174,315 (GRCm39) missense probably damaging 0.99
IGL01448:Reln APN 5 22,245,403 (GRCm39) missense probably benign 0.40
IGL01612:Reln APN 5 22,101,928 (GRCm39) missense probably damaging 0.99
IGL01695:Reln APN 5 22,125,436 (GRCm39) missense probably damaging 1.00
IGL01718:Reln APN 5 22,152,512 (GRCm39) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,549,244 (GRCm39) nonsense probably null
IGL01875:Reln APN 5 22,109,715 (GRCm39) missense probably benign
IGL02013:Reln APN 5 22,155,877 (GRCm39) missense probably damaging 1.00
IGL02031:Reln APN 5 22,184,014 (GRCm39) missense probably damaging 0.99
IGL02186:Reln APN 5 22,114,956 (GRCm39) missense probably damaging 1.00
IGL02228:Reln APN 5 22,109,729 (GRCm39) missense probably damaging 0.99
IGL02248:Reln APN 5 22,115,990 (GRCm39) missense probably damaging 1.00
IGL02336:Reln APN 5 22,134,132 (GRCm39) missense probably damaging 1.00
IGL02352:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,285,789 (GRCm39) nonsense probably null
IGL02408:Reln APN 5 22,106,617 (GRCm39) missense probably benign 0.44
IGL02415:Reln APN 5 22,176,949 (GRCm39) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,245,425 (GRCm39) missense probably benign 0.00
IGL02540:Reln APN 5 22,239,750 (GRCm39) missense probably damaging 0.96
IGL02624:Reln APN 5 22,308,355 (GRCm39) missense probably benign 0.09
IGL02720:Reln APN 5 22,202,939 (GRCm39) missense probably damaging 0.99
IGL02894:Reln APN 5 22,090,546 (GRCm39) missense possibly damaging 0.72
IGL02999:Reln APN 5 22,200,363 (GRCm39) missense probably damaging 1.00
IGL03125:Reln APN 5 22,115,842 (GRCm39) missense probably damaging 1.00
IGL03298:Reln APN 5 22,115,834 (GRCm39) missense probably damaging 0.99
Fishing UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
P0020:Reln UTSW 5 22,311,058 (GRCm39) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R0018:Reln UTSW 5 22,130,369 (GRCm39) missense probably benign 0.01
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0127:Reln UTSW 5 22,209,134 (GRCm39) missense probably damaging 1.00
R0135:Reln UTSW 5 22,333,647 (GRCm39) missense probably damaging 0.99
R0144:Reln UTSW 5 22,153,447 (GRCm39) missense probably damaging 0.97
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0266:Reln UTSW 5 22,193,774 (GRCm39) missense probably damaging 1.00
R0269:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0280:Reln UTSW 5 22,432,511 (GRCm39) splice site probably benign
R0333:Reln UTSW 5 22,134,240 (GRCm39) missense probably damaging 0.97
R0357:Reln UTSW 5 22,155,820 (GRCm39) missense probably damaging 1.00
R0359:Reln UTSW 5 22,253,798 (GRCm39) missense probably damaging 0.98
R0506:Reln UTSW 5 22,125,494 (GRCm39) missense probably damaging 0.97
R0534:Reln UTSW 5 22,152,406 (GRCm39) missense probably damaging 0.99
R0535:Reln UTSW 5 22,256,274 (GRCm39) splice site probably benign
R0541:Reln UTSW 5 22,185,107 (GRCm39) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,215,148 (GRCm39) missense probably benign 0.36
R0617:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0634:Reln UTSW 5 22,223,867 (GRCm39) missense probably damaging 1.00
R0653:Reln UTSW 5 22,118,228 (GRCm39) missense probably benign 0.44
R0704:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0706:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0959:Reln UTSW 5 22,432,626 (GRCm39) missense probably damaging 0.96
R1066:Reln UTSW 5 22,239,662 (GRCm39) missense probably damaging 1.00
R1110:Reln UTSW 5 22,239,773 (GRCm39) missense probably benign
R1163:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R1222:Reln UTSW 5 22,191,953 (GRCm39) missense probably null 0.97
R1226:Reln UTSW 5 22,115,864 (GRCm39) missense probably damaging 1.00
R1440:Reln UTSW 5 22,333,600 (GRCm39) splice site probably benign
R1532:Reln UTSW 5 22,239,742 (GRCm39) missense probably damaging 0.99
R1552:Reln UTSW 5 22,165,376 (GRCm39) missense probably benign 0.01
R1565:Reln UTSW 5 22,130,211 (GRCm39) missense probably benign 0.05
R1618:Reln UTSW 5 22,265,366 (GRCm39) missense probably benign 0.01
R1636:Reln UTSW 5 22,203,681 (GRCm39) missense probably damaging 0.99
R1664:Reln UTSW 5 22,134,084 (GRCm39) missense probably damaging 1.00
R1716:Reln UTSW 5 22,160,093 (GRCm39) missense probably damaging 0.98
R1759:Reln UTSW 5 22,215,287 (GRCm39) missense probably damaging 0.99
R1835:Reln UTSW 5 22,184,000 (GRCm39) missense probably damaging 1.00
R1907:Reln UTSW 5 22,249,960 (GRCm39) critical splice donor site probably null
R1991:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2046:Reln UTSW 5 22,147,625 (GRCm39) missense probably benign 0.01
R2072:Reln UTSW 5 22,124,175 (GRCm39) missense probably damaging 1.00
R2103:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,223,998 (GRCm39) missense probably damaging 1.00
R2120:Reln UTSW 5 22,174,083 (GRCm39) missense probably damaging 1.00
R2216:Reln UTSW 5 22,253,003 (GRCm39) missense probably benign 0.30
R2219:Reln UTSW 5 22,177,045 (GRCm39) missense possibly damaging 0.88
R2228:Reln UTSW 5 22,192,076 (GRCm39) missense possibly damaging 0.69
R2306:Reln UTSW 5 22,101,784 (GRCm39) missense probably damaging 1.00
R2316:Reln UTSW 5 22,359,954 (GRCm39) missense probably benign 0.00
R2321:Reln UTSW 5 22,120,018 (GRCm39) missense probably damaging 0.99
R2512:Reln UTSW 5 22,184,688 (GRCm39) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,549,367 (GRCm39) missense unknown
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,245,418 (GRCm39) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3706:Reln UTSW 5 22,200,587 (GRCm39) splice site probably benign
R3713:Reln UTSW 5 22,109,732 (GRCm39) missense probably damaging 0.99
R3770:Reln UTSW 5 22,153,564 (GRCm39) missense probably damaging 1.00
R3836:Reln UTSW 5 22,116,012 (GRCm39) missense probably damaging 1.00
R3887:Reln UTSW 5 22,115,847 (GRCm39) missense possibly damaging 0.92
R3972:Reln UTSW 5 22,183,999 (GRCm39) missense probably damaging 0.99
R3975:Reln UTSW 5 22,200,364 (GRCm39) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,432,628 (GRCm39) missense probably benign 0.45
R4044:Reln UTSW 5 22,333,630 (GRCm39) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,239,582 (GRCm39) missense probably damaging 1.00
R4297:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4298:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4299:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4518:Reln UTSW 5 22,106,741 (GRCm39) missense probably benign 0.44
R4615:Reln UTSW 5 22,177,870 (GRCm39) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,357,461 (GRCm39) missense probably benign 0.17
R4720:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R4721:Reln UTSW 5 22,124,220 (GRCm39) missense probably damaging 0.99
R4771:Reln UTSW 5 22,254,698 (GRCm39) missense probably damaging 1.00
R4794:Reln UTSW 5 22,549,183 (GRCm39) missense probably damaging 0.98
R4840:Reln UTSW 5 22,223,844 (GRCm39) splice site probably null
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4896:Reln UTSW 5 22,160,236 (GRCm39) missense probably damaging 1.00
R4908:Reln UTSW 5 22,184,718 (GRCm39) missense probably benign 0.02
R4912:Reln UTSW 5 22,130,191 (GRCm39) missense probably benign 0.29
R4922:Reln UTSW 5 22,200,585 (GRCm39) critical splice acceptor site probably null
R4975:Reln UTSW 5 22,165,424 (GRCm39) missense probably damaging 1.00
R4976:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5020:Reln UTSW 5 22,239,636 (GRCm39) missense probably damaging 1.00
R5037:Reln UTSW 5 22,153,510 (GRCm39) missense probably damaging 1.00
R5082:Reln UTSW 5 22,101,075 (GRCm39) missense probably benign 0.00
R5119:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5125:Reln UTSW 5 22,118,239 (GRCm39) missense possibly damaging 0.78
R5137:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R5152:Reln UTSW 5 22,153,627 (GRCm39) missense probably damaging 1.00
R5154:Reln UTSW 5 22,193,763 (GRCm39) missense probably damaging 0.99
R5259:Reln UTSW 5 22,308,395 (GRCm39) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,216,161 (GRCm39) missense probably damaging 1.00
R5386:Reln UTSW 5 22,244,527 (GRCm39) missense probably benign
R5400:Reln UTSW 5 22,184,712 (GRCm39) missense probably damaging 1.00
R5478:Reln UTSW 5 22,209,201 (GRCm39) missense probably benign 0.00
R5514:Reln UTSW 5 22,176,883 (GRCm39) missense possibly damaging 0.93
R5529:Reln UTSW 5 22,137,713 (GRCm39) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,244,663 (GRCm39) nonsense probably null
R5648:Reln UTSW 5 22,203,570 (GRCm39) missense probably benign 0.04
R5649:Reln UTSW 5 22,106,623 (GRCm39) missense probably benign 0.33
R5744:Reln UTSW 5 22,311,081 (GRCm39) missense probably null 0.39
R5782:Reln UTSW 5 22,223,054 (GRCm39) missense probably benign 0.01
R5815:Reln UTSW 5 22,152,431 (GRCm39) missense probably damaging 0.99
R5838:Reln UTSW 5 22,104,111 (GRCm39) missense probably damaging 0.97
R6162:Reln UTSW 5 22,116,048 (GRCm39) missense probably damaging 1.00
R6219:Reln UTSW 5 22,153,594 (GRCm39) missense probably damaging 1.00
R6259:Reln UTSW 5 22,265,331 (GRCm39) missense probably damaging 0.99
R6279:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6299:Reln UTSW 5 22,491,942 (GRCm39) missense possibly damaging 0.71
R6300:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6314:Reln UTSW 5 22,357,482 (GRCm39) nonsense probably null
R6351:Reln UTSW 5 22,106,661 (GRCm39) nonsense probably null
R6369:Reln UTSW 5 22,256,359 (GRCm39) missense probably benign 0.03
R6374:Reln UTSW 5 22,285,712 (GRCm39) missense probably benign 0.06
R6425:Reln UTSW 5 22,116,018 (GRCm39) nonsense probably null
R6442:Reln UTSW 5 22,137,774 (GRCm39) missense probably benign
R6445:Reln UTSW 5 22,124,212 (GRCm39) missense probably benign 0.05
R6554:Reln UTSW 5 22,101,838 (GRCm39) missense probably damaging 1.00
R6641:Reln UTSW 5 22,134,132 (GRCm39) missense probably damaging 1.00
R6768:Reln UTSW 5 22,183,905 (GRCm39) missense probably damaging 0.99
R6859:Reln UTSW 5 22,239,568 (GRCm39) missense probably damaging 1.00
R6896:Reln UTSW 5 22,104,177 (GRCm39) missense probably benign 0.18
R6932:Reln UTSW 5 22,190,855 (GRCm39) missense probably benign 0.00
R6948:Reln UTSW 5 22,177,033 (GRCm39) missense probably damaging 1.00
R6959:Reln UTSW 5 22,181,562 (GRCm39) missense probably damaging 1.00
R7085:Reln UTSW 5 22,120,085 (GRCm39) nonsense probably null
R7091:Reln UTSW 5 22,104,027 (GRCm39) missense probably null 0.08
R7135:Reln UTSW 5 22,181,594 (GRCm39) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,311,095 (GRCm39) missense probably damaging 0.97
R7167:Reln UTSW 5 22,147,618 (GRCm39) missense probably damaging 1.00
R7190:Reln UTSW 5 22,252,945 (GRCm39) missense probably damaging 1.00
R7256:Reln UTSW 5 22,183,921 (GRCm39) missense probably benign 0.03
R7393:Reln UTSW 5 22,181,349 (GRCm39) missense probably damaging 0.99
R7399:Reln UTSW 5 22,256,365 (GRCm39) missense probably damaging 0.99
R7400:Reln UTSW 5 22,176,932 (GRCm39) missense probably damaging 0.99
R7426:Reln UTSW 5 22,176,951 (GRCm39) missense probably damaging 1.00
R7463:Reln UTSW 5 22,308,433 (GRCm39) missense probably damaging 0.98
R7470:Reln UTSW 5 22,147,739 (GRCm39) missense probably damaging 0.99
R7473:Reln UTSW 5 22,134,125 (GRCm39) missense probably benign 0.25
R7501:Reln UTSW 5 22,432,636 (GRCm39) missense possibly damaging 0.91
R7542:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R7544:Reln UTSW 5 22,181,276 (GRCm39) nonsense probably null
R7588:Reln UTSW 5 22,090,566 (GRCm39) missense probably benign 0.03
R7631:Reln UTSW 5 22,176,933 (GRCm39) missense probably damaging 0.97
R7644:Reln UTSW 5 22,183,929 (GRCm39) missense probably benign 0.39
R7834:Reln UTSW 5 22,244,633 (GRCm39) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,339,690 (GRCm39) missense probably benign 0.00
R7938:Reln UTSW 5 22,155,870 (GRCm39) missense probably damaging 0.97
R8006:Reln UTSW 5 22,104,082 (GRCm39) nonsense probably null
R8062:Reln UTSW 5 22,176,990 (GRCm39) missense probably benign 0.00
R8222:Reln UTSW 5 22,136,475 (GRCm39) nonsense probably null
R8266:Reln UTSW 5 22,223,085 (GRCm39) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,209,110 (GRCm39) missense probably damaging 1.00
R8487:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R8523:Reln UTSW 5 22,209,229 (GRCm39) missense probably damaging 1.00
R8751:Reln UTSW 5 22,147,672 (GRCm39) missense probably benign 0.37
R8801:Reln UTSW 5 22,155,854 (GRCm39) missense possibly damaging 0.94
R8802:Reln UTSW 5 22,130,257 (GRCm39) missense probably damaging 0.98
R8978:Reln UTSW 5 22,090,512 (GRCm39) missense possibly damaging 0.85
R8988:Reln UTSW 5 22,104,155 (GRCm39) missense probably damaging 0.97
R8995:Reln UTSW 5 22,184,577 (GRCm39) missense probably benign 0.00
R9022:Reln UTSW 5 22,181,613 (GRCm39) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,253,036 (GRCm39) missense probably damaging 1.00
R9069:Reln UTSW 5 22,216,059 (GRCm39) missense probably damaging 1.00
R9089:Reln UTSW 5 22,130,198 (GRCm39) missense probably benign 0.01
R9126:Reln UTSW 5 22,160,194 (GRCm39) missense probably damaging 1.00
R9172:Reln UTSW 5 22,155,815 (GRCm39) critical splice donor site probably null
R9182:Reln UTSW 5 22,106,617 (GRCm39) missense probably benign 0.44
R9196:Reln UTSW 5 22,357,471 (GRCm39) missense probably damaging 1.00
R9211:Reln UTSW 5 22,549,200 (GRCm39) nonsense probably null
R9241:Reln UTSW 5 22,174,067 (GRCm39) missense probably damaging 0.99
R9244:Reln UTSW 5 22,120,151 (GRCm39) missense probably damaging 0.99
R9281:Reln UTSW 5 22,153,545 (GRCm39) missense probably damaging 1.00
R9295:Reln UTSW 5 22,209,209 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,193,705 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,285,689 (GRCm39) missense probably benign 0.01
R9309:Reln UTSW 5 22,176,866 (GRCm39) missense probably benign 0.37
R9338:Reln UTSW 5 22,202,937 (GRCm39) missense probably damaging 0.98
R9381:Reln UTSW 5 22,549,202 (GRCm39) missense possibly damaging 0.93
R9430:Reln UTSW 5 22,120,105 (GRCm39) missense probably damaging 1.00
R9509:Reln UTSW 5 22,549,198 (GRCm39) missense possibly damaging 0.93
R9515:Reln UTSW 5 22,125,508 (GRCm39) missense possibly damaging 0.46
R9717:Reln UTSW 5 22,136,427 (GRCm39) missense probably benign 0.26
R9745:Reln UTSW 5 22,152,525 (GRCm39) missense probably damaging 1.00
R9778:Reln UTSW 5 22,155,943 (GRCm39) missense probably damaging 1.00
Z1176:Reln UTSW 5 22,184,022 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,209,080 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,174,239 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,432,634 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,359,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTTTACCTGGATGCAAGG -3'
(R):5'- CAGAATTTACAGAGGTCCTGCG -3'

Sequencing Primer
(F):5'- CAAGGGACCTTGGAATGGC -3'
(R):5'- ACAGAGGTCCTGCGTTGAGTC -3'
Posted On 2018-04-27