Incidental Mutation 'R6371:Clrn2'
List |< first << previous [record 11 of 50] next >> last >|
ID513517
Institutional Source Beutler Lab
Gene Symbol Clrn2
Ensembl Gene ENSMUSG00000049530
Gene Nameclarin 2
SynonymsEG624224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45453751-45464149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45460198 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000058204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053250
AA Change: I137T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530
AA Change: I137T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the clarin family of genes. The clarins appear to belong to a large superfamily of small integral membrane glycoproteins with four transmembrane domains. The exact function of this gene is unknown. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Clrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Clrn2 APN 5 45463969 utr 3 prime probably benign
IGL01538:Clrn2 APN 5 45460066 missense probably damaging 1.00
IGL01585:Clrn2 APN 5 45460158 missense probably benign 0.00
IGL01783:Clrn2 APN 5 45460161 missense probably benign
IGL02479:Clrn2 APN 5 45463912 missense probably benign 0.03
IGL02709:Clrn2 APN 5 45460153 missense probably damaging 1.00
IGL03220:Clrn2 APN 5 45463728 missense probably damaging 1.00
R1443:Clrn2 UTSW 5 45460111 missense probably damaging 1.00
R1942:Clrn2 UTSW 5 45453995 missense probably benign 0.26
R2258:Clrn2 UTSW 5 45453962 missense probably benign 0.03
R4806:Clrn2 UTSW 5 45454004 missense probably damaging 1.00
R5943:Clrn2 UTSW 5 45463719 missense probably benign 0.01
R5987:Clrn2 UTSW 5 45454027 missense probably benign 0.09
R6029:Clrn2 UTSW 5 45460186 missense probably damaging 1.00
R6474:Clrn2 UTSW 5 45463732 missense probably benign 0.04
R6881:Clrn2 UTSW 5 45453822 nonsense probably null
R6939:Clrn2 UTSW 5 45453754 unclassified probably benign
R7156:Clrn2 UTSW 5 45453916 missense probably damaging 0.99
R7186:Clrn2 UTSW 5 45453773 unclassified probably benign
R7392:Clrn2 UTSW 5 45463909 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTTGTGAAAGGAGCCACACTC -3'
(R):5'- TTCCAGACTGCAATAAAAGTGCC -3'

Sequencing Primer
(F):5'- AGGAGCCACACTCTGACCTTG -3'
(R):5'- GACTGCAATAAAAGTGCCCTTTAGC -3'
Posted On2018-04-27