Incidental Mutation 'R6371:Fam71e2'
List |< first << previous [record 15 of 50] next >> last >|
ID513518
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Namefamily with sequence similarity 71, member E2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4753226-4771302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4759359 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 257 (V257A)
Ref Sequence ENSEMBL: ENSMUSP00000133885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163574] [ENSMUST00000174409]
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174409
AA Change: V257A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: V257A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R0981:Fam71e2 UTSW 7 4757589 splice site probably null
R1428:Fam71e2 UTSW 7 4757688 missense possibly damaging 0.68
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5491:Fam71e2 UTSW 7 4757926 missense probably benign 0.05
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6025:Fam71e2 UTSW 7 4758144 missense probably benign 0.01
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7037:Fam71e2 UTSW 7 4758585 utr 3 prime probably benign
R7381:Fam71e2 UTSW 7 4757682 missense
Z1177:Fam71e2 UTSW 7 4757728 missense
Predicted Primers PCR Primer
(F):5'- CAGGTTCATGTAGGTGGCAG -3'
(R):5'- CCAAGGTGAAGTAGTCAGTGTG -3'

Sequencing Primer
(F):5'- CAGAGGGTGGGTATTGCTCATAC -3'
(R):5'- AGATTCAAGTGTGTGAAAGTATGTG -3'
Posted On2018-04-27