Incidental Mutation 'R6371:Taok2'
ID513521
Institutional Source Beutler Lab
Gene Symbol Taok2
Ensembl Gene ENSMUSG00000059981
Gene NameTAO kinase 2
SynonymsMAP3K17, TAO2, 1110033K02Rik, PSK1, TAO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126865678-126884703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126870147 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1170 (R1170W)
Ref Sequence ENSEMBL: ENSMUSP00000112963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000071268] [ENSMUST00000117394] [ENSMUST00000214525]
Predicted Effect probably benign
Transcript: ENSMUST00000037248
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117394
AA Change: R1170W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112963
Gene: ENSMUSG00000059981
AA Change: R1170W

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
transmembrane domain 962 984 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1017 1039 N/A INTRINSIC
transmembrane domain 1052 1074 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1197 1215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Meta Mutation Damage Score 0.2348 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. Mice homozygous for a targeted allele exhibit resistance to the ataxic effect of alcohol, reduced blood ethanol content, increased alcohol consumption, impaired CPP for alcohol, and impaired habituation in an open field. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Taok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Taok2 APN 7 126872411 missense probably damaging 0.98
IGL01153:Taok2 APN 7 126871032 missense probably damaging 0.99
IGL02689:Taok2 APN 7 126876098 missense probably damaging 0.99
R0049:Taok2 UTSW 7 126866411 missense possibly damaging 0.92
R0601:Taok2 UTSW 7 126879433 missense probably damaging 1.00
R0976:Taok2 UTSW 7 126875151 missense possibly damaging 0.77
R1456:Taok2 UTSW 7 126880141 missense probably benign 0.09
R1643:Taok2 UTSW 7 126875938 unclassified probably benign
R2084:Taok2 UTSW 7 126870191 missense probably benign 0.04
R2212:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R2471:Taok2 UTSW 7 126875100 missense probably damaging 0.98
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3412:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R4085:Taok2 UTSW 7 126874725 missense possibly damaging 0.90
R4440:Taok2 UTSW 7 126866521 missense possibly damaging 0.85
R4775:Taok2 UTSW 7 126870768 missense probably damaging 0.99
R4787:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4788:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4791:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4927:Taok2 UTSW 7 126876041 missense probably damaging 1.00
R5651:Taok2 UTSW 7 126880283 missense probably damaging 1.00
R6408:Taok2 UTSW 7 126870992 missense probably benign
R6605:Taok2 UTSW 7 126878758 missense probably damaging 1.00
R6828:Taok2 UTSW 7 126871875 intron probably null
R6863:Taok2 UTSW 7 126871937 missense probably damaging 0.99
R6962:Taok2 UTSW 7 126866916 critical splice acceptor site probably null
R6967:Taok2 UTSW 7 126870392 missense probably damaging 0.98
R7127:Taok2 UTSW 7 126867154 missense possibly damaging 0.82
R7187:Taok2 UTSW 7 126872380 missense probably damaging 0.99
R7307:Taok2 UTSW 7 126866818 missense probably damaging 1.00
R7325:Taok2 UTSW 7 126871088 missense probably benign
R7429:Taok2 UTSW 7 126870677 missense possibly damaging 0.95
R7497:Taok2 UTSW 7 126874878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCGAGTCTGAGATCTC -3'
(R):5'- TGAGGATTTTGCTACGCCTG -3'

Sequencing Primer
(F):5'- AGTCTGAGATCTCCGCCCAG -3'
(R):5'- ATGGTCTTTCGGGCCCTACAG -3'
Posted On2018-04-27