Incidental Mutation 'R6371:Gpt2'
ID513525
Institutional Source Beutler Lab
Gene Symbol Gpt2
Ensembl Gene ENSMUSG00000031700
Gene Nameglutamic pyruvate transaminase (alanine aminotransferase) 2
SynonymsALT2, 4631422C05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85492576-85527560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85518052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 325 (E325K)
Ref Sequence ENSEMBL: ENSMUSP00000034136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034136] [ENSMUST00000132932]
Predicted Effect probably benign
Transcript: ENSMUST00000034136
AA Change: E325K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034136
Gene: ENSMUSG00000031700
AA Change: E325K

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:Aminotran_1_2 110 510 6.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132932
SMART Domains Protein: ENSMUSP00000115968
Gene: ENSMUSG00000031700

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
PDB:3IHJ|A 48 148 6e-63 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143846
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity, reduced postnatal brain growth, various metabolic defects in pathways involving amino acid metabolism, the TCA cycle and neuroprotective mechanisms, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Gpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Gpt2 APN 8 85512324 missense probably benign
IGL01611:Gpt2 APN 8 85519538 nonsense probably null
IGL02385:Gpt2 APN 8 85516153 splice site probably null
IGL02484:Gpt2 APN 8 85516233 missense probably damaging 1.00
IGL02589:Gpt2 APN 8 85516166 nonsense probably null
IGL02669:Gpt2 APN 8 85523279 missense probably benign 0.02
R1191:Gpt2 UTSW 8 85509272 missense probably damaging 1.00
R1599:Gpt2 UTSW 8 85512234 missense probably damaging 1.00
R1944:Gpt2 UTSW 8 85517996 missense probably damaging 1.00
R1953:Gpt2 UTSW 8 85521384 missense probably benign 0.00
R1962:Gpt2 UTSW 8 85493135 missense probably damaging 0.99
R1982:Gpt2 UTSW 8 85516203 missense possibly damaging 0.75
R2283:Gpt2 UTSW 8 85516189 missense probably benign
R3785:Gpt2 UTSW 8 85525573 missense probably benign
R3786:Gpt2 UTSW 8 85525573 missense probably benign
R3787:Gpt2 UTSW 8 85525573 missense probably benign
R4402:Gpt2 UTSW 8 85525559 missense probably benign 0.32
R4974:Gpt2 UTSW 8 85519439 splice site probably benign
R5457:Gpt2 UTSW 8 85512338 missense possibly damaging 0.90
R5589:Gpt2 UTSW 8 85493111 missense probably damaging 1.00
R5734:Gpt2 UTSW 8 85523256 missense probably benign 0.17
R5924:Gpt2 UTSW 8 85493004 missense probably damaging 1.00
R6651:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6652:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6895:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6898:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6923:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6955:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6956:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7112:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7113:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7115:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7124:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7125:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7327:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7486:Gpt2 UTSW 8 85525606 missense probably damaging 0.98
R7582:Gpt2 UTSW 8 85519516 missense probably damaging 1.00
R7986:Gpt2 UTSW 8 85509210 nonsense probably null
R8274:Gpt2 UTSW 8 85516224 missense probably benign 0.38
R8376:Gpt2 UTSW 8 85493065 missense probably benign 0.00
X0058:Gpt2 UTSW 8 85518019 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTGTGGCCTTCACCTGACAAC -3'
(R):5'- TTACACCAGCGGCAAGTGATG -3'

Sequencing Primer
(F):5'- ACAGGTTAACTCCGTACCTATG -3'
(R):5'- GAAGGCTGCTTTCTAACCATG -3'
Posted On2018-04-27