Incidental Mutation 'R6371:Fbxl2'
ID513526
Institutional Source Beutler Lab
Gene Symbol Fbxl2
Ensembl Gene ENSMUSG00000032507
Gene NameF-box and leucine-rich repeat protein 2
Synonyms2810423A21Rik, Fbl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location113963637-114046191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113989383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 170 (T170I)
Ref Sequence ENSEMBL: ENSMUSP00000114075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035090] [ENSMUST00000117537] [ENSMUST00000143180]
Predicted Effect probably damaging
Transcript: ENSMUST00000035090
AA Change: T170I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035090
Gene: ENSMUSG00000032507
AA Change: T170I

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117537
AA Change: T170I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507
AA Change: T170I

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139757
Predicted Effect probably benign
Transcript: ENSMUST00000143180
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Fbxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fbxl2 APN 9 113983979 splice site probably benign
IGL02165:Fbxl2 APN 9 114018031 missense probably benign 0.06
IGL02535:Fbxl2 APN 9 113979507 missense probably benign 0.25
R0145:Fbxl2 UTSW 9 113985325 missense probably damaging 1.00
R1668:Fbxl2 UTSW 9 113989146 missense probably benign 0.00
R1694:Fbxl2 UTSW 9 114003171 missense probably damaging 0.99
R1964:Fbxl2 UTSW 9 113989169 missense probably benign 0.00
R2993:Fbxl2 UTSW 9 113989416 missense possibly damaging 0.48
R3894:Fbxl2 UTSW 9 114003193 missense probably damaging 1.00
R4235:Fbxl2 UTSW 9 113989163 missense probably benign 0.03
R4342:Fbxl2 UTSW 9 113985306 missense probably benign
R5310:Fbxl2 UTSW 9 113986508 missense possibly damaging 0.78
R5509:Fbxl2 UTSW 9 113985347 splice site probably null
R5696:Fbxl2 UTSW 9 113986478 missense probably damaging 1.00
R6232:Fbxl2 UTSW 9 113986448 missense probably damaging 0.98
R6803:Fbxl2 UTSW 9 113984549 missense probably damaging 1.00
R7530:Fbxl2 UTSW 9 113989173 missense probably benign 0.01
Z1177:Fbxl2 UTSW 9 113989345 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTCGTCCTCTAACTGAGTG -3'
(R):5'- CATTCCTGGTGGCTTCACTG -3'

Sequencing Primer
(F):5'- CGTCCTCTAACTGAGTGGATGGAG -3'
(R):5'- CTTCACTGGGTGAGGAGGAAGTG -3'
Posted On2018-04-27