Incidental Mutation 'R6371:Srebf1'
List |< first << previous [record 42 of 50] next >> last >|
ID513529
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Namesterol regulatory element binding transcription factor 1
SynonymsSREBP-1a, SREBP-1c, ADD-1, SREBP1c, SREBP-1, bHLHd1, SREBP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6371 (G1)
Quality Score181.009
Status Validated
Chromosome11
Chromosomal Location60199089-60222581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60203515 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 591 (S591R)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000064190] [ENSMUST00000102688] [ENSMUST00000144942] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000020846
AA Change: S615R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: S615R

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064190
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102688
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129869
Predicted Effect unknown
Transcript: ENSMUST00000134660
AA Change: S556R
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: S556R

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141161
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: S591R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: S591R

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156304
Predicted Effect probably benign
Transcript: ENSMUST00000171108
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185099
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60204131 missense probably benign 0.01
IGL02097:Srebf1 APN 11 60202824 missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60201713 critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60220458 missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60207076 synonymous silent
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0550:Srebf1 UTSW 11 60201676 missense probably benign 0.00
R0654:Srebf1 UTSW 11 60204116 missense probably benign
R0707:Srebf1 UTSW 11 60204116 missense probably benign
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1584:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1899:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1900:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1905:Srebf1 UTSW 11 60204493 missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60206502 missense probably benign
R2191:Srebf1 UTSW 11 60220539 missense probably damaging 1.00
R2267:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R2268:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60210358 utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60207104 missense possibly damaging 0.82
R6376:Srebf1 UTSW 11 60203535 missense probably null 0.19
R7009:Srebf1 UTSW 11 60200526 missense probably damaging 1.00
R7029:Srebf1 UTSW 11 60206984 missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60205867 missense probably benign 0.03
R7569:Srebf1 UTSW 11 60200121 missense possibly damaging 0.69
R8317:Srebf1 UTSW 11 60200657 missense possibly damaging 0.62
R8370:Srebf1 UTSW 11 60202196 missense probably benign
RF009:Srebf1 UTSW 11 60204116 missense probably benign
X0017:Srebf1 UTSW 11 60202881 missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60203427 missense probably benign 0.00
Z1176:Srebf1 UTSW 11 60207156 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGCCTGCAAAGTGGGTGAG -3'
(R):5'- TCAGAGCTCCTGACTCTAGG -3'

Sequencing Primer
(F):5'- CTGCAAAGTGGGTGAGGCATG -3'
(R):5'- ACTCTAGGGGCCCAGACAAG -3'
Posted On2018-04-27