Incidental Mutation 'R6371:Cdk12'
ID513530
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98245288 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1123 (T1123A)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect unknown
Transcript: ENSMUST00000003203
AA Change: T1123A
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: T1123A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107538
AA Change: T1123A
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: T1123A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107539
AA Change: T1123A
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: T1123A

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147441
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7975:Cdk12 UTSW 11 98221102 missense unknown
R8507:Cdk12 UTSW 11 98250285 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGATTCAAAATGAAACTGTGCC -3'
(R):5'- TCAGGAGTTGTCTGTTCAGCAG -3'

Sequencing Primer
(F):5'- GATTCAAAATGAAACTGTGCCTTTAG -3'
(R):5'- GTCTGTTCAGCAGGAGGC -3'
Posted On2018-04-27