Incidental Mutation 'R6371:Cep170b'
List |< first << previous [record 8 of 50] next >> last >|
ID513534
Institutional Source Beutler Lab
Gene Symbol Cep170b
Ensembl Gene ENSMUSG00000072825
Gene Namecentrosomal protein 170B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R6371 (G1)
Quality Score224.009
Status Validated
Chromosome12
Chromosomal Location112720455-112746592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112740945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 375 (D375G)
Ref Sequence ENSEMBL: ENSMUSP00000089930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092279] [ENSMUST00000101018] [ENSMUST00000179041] [ENSMUST00000220627] [ENSMUST00000222711]
Predicted Effect probably damaging
Transcript: ENSMUST00000092279
AA Change: D375G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089930
Gene: ENSMUSG00000072825
AA Change: D375G

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
Pfam:CEP170_C 204 598 8.9e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101018
AA Change: D1291G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098580
Gene: ENSMUSG00000072825
AA Change: D1291G

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 831 1514 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179041
AA Change: D1291G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137331
Gene: ENSMUSG00000072825
AA Change: D1291G

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 832 1510 4.3e-303 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220627
AA Change: D1256G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222612
Predicted Effect probably damaging
Transcript: ENSMUST00000222711
AA Change: D1291G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223104
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Cep170b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cep170b APN 12 112735194 missense probably damaging 1.00
IGL01313:Cep170b APN 12 112735652 missense probably damaging 1.00
IGL01317:Cep170b APN 12 112737644 missense probably damaging 1.00
IGL01660:Cep170b APN 12 112744160 missense probably damaging 1.00
IGL02032:Cep170b APN 12 112737333 critical splice donor site probably null
IGL02505:Cep170b APN 12 112743070 missense probably damaging 1.00
IGL02966:Cep170b APN 12 112736444 missense possibly damaging 0.75
IGL03111:Cep170b APN 12 112735179 missense probably damaging 1.00
IGL03367:Cep170b APN 12 112737238 missense probably benign 0.00
R0348:Cep170b UTSW 12 112736806 missense probably damaging 1.00
R0562:Cep170b UTSW 12 112739189 missense probably benign 0.00
R0909:Cep170b UTSW 12 112732039 missense probably null 0.06
R1217:Cep170b UTSW 12 112740905 missense probably damaging 0.99
R1300:Cep170b UTSW 12 112737257 missense probably benign 0.02
R1647:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1648:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1652:Cep170b UTSW 12 112733513 missense probably damaging 0.99
R1737:Cep170b UTSW 12 112736627 missense possibly damaging 0.71
R1936:Cep170b UTSW 12 112735738 missense probably damaging 1.00
R1962:Cep170b UTSW 12 112738061 missense probably damaging 1.00
R2094:Cep170b UTSW 12 112735730 missense possibly damaging 0.90
R2208:Cep170b UTSW 12 112738985 missense probably benign 0.00
R3418:Cep170b UTSW 12 112738468 nonsense probably null
R3735:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R3736:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R4299:Cep170b UTSW 12 112739305 missense probably damaging 1.00
R4577:Cep170b UTSW 12 112744718 missense probably damaging 1.00
R5199:Cep170b UTSW 12 112744147 missense probably damaging 1.00
R5512:Cep170b UTSW 12 112733485 missense possibly damaging 0.86
R5575:Cep170b UTSW 12 112735632 missense probably damaging 1.00
R5643:Cep170b UTSW 12 112740841 missense probably benign 0.35
R6074:Cep170b UTSW 12 112744155 missense probably damaging 1.00
R6265:Cep170b UTSW 12 112744559 missense probably damaging 1.00
R6376:Cep170b UTSW 12 112732068 missense probably damaging 0.99
R7055:Cep170b UTSW 12 112735715 missense probably damaging 1.00
R7137:Cep170b UTSW 12 112735167 missense probably benign
R7226:Cep170b UTSW 12 112737925 missense possibly damaging 0.80
R7615:Cep170b UTSW 12 112744665 missense probably damaging 1.00
R7831:Cep170b UTSW 12 112744800 missense probably benign 0.08
R8178:Cep170b UTSW 12 112739285 missense possibly damaging 0.92
Z1176:Cep170b UTSW 12 112741012 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCACTGAGTGTTCTCTGTTC -3'
(R):5'- AATCTCTAAATCTACTCAGGGTCAG -3'

Sequencing Primer
(F):5'- GTTCTCGCTTCTGAATCCAAAC -3'
(R):5'- TCTACTCAGGGTCAGAAGCC -3'
Posted On2018-04-27