Incidental Mutation 'R6371:Arsb'
List |< first << previous [record 3 of 50] next >> last >|
ID513536
Institutional Source Beutler Lab
Gene Symbol Arsb
Ensembl Gene ENSMUSG00000042082
Gene Namearylsulfatase B
SynonymsAs-1r, As1-s, Ast-1, As-1s, Asr-1, 1110007C02Rik, As1, As1-r, As1-t, As-1, As-1t
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93771630-93943016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93790066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 115 (I115F)
Ref Sequence ENSEMBL: ENSMUSP00000088964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091403
AA Change: I115F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088964
Gene: ENSMUSG00000042082
AA Change: I115F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Sulfatase 46 364 1.7e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220652
Meta Mutation Damage Score 0.4744 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutation of this gene results in development of shortened limbs and snout and a broadened head after 4 weeks of age. Mutant animals have elevated concentrations of glucosaminoglycans in the urine and irregular cartilage structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Arsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Arsb APN 13 93790100 missense probably benign 0.07
IGL00334:Arsb APN 13 93939279 missense probably benign 0.01
IGL01560:Arsb APN 13 93807598 missense probably benign 0.01
IGL02408:Arsb APN 13 93794162 missense probably benign 0.19
IGL03396:Arsb APN 13 93939317 missense probably benign 0.01
dipper UTSW 13 93790066 missense possibly damaging 0.95
ouzel UTSW 13 93794220 critical splice donor site probably null
rivulet UTSW 13 93862327 missense probably damaging 1.00
R0145:Arsb UTSW 13 93862287 missense possibly damaging 0.60
R0379:Arsb UTSW 13 93940627 missense probably benign 0.20
R0488:Arsb UTSW 13 93940505 missense probably benign
R0560:Arsb UTSW 13 93790198 missense possibly damaging 0.66
R1938:Arsb UTSW 13 93862150 missense probably damaging 1.00
R1968:Arsb UTSW 13 93807559 missense probably benign 0.00
R2209:Arsb UTSW 13 93862101 missense probably benign 0.14
R2224:Arsb UTSW 13 93794171 missense probably damaging 1.00
R2520:Arsb UTSW 13 93940699 nonsense probably null
R4476:Arsb UTSW 13 93807595 missense probably damaging 1.00
R4910:Arsb UTSW 13 93771977 missense probably benign
R5153:Arsb UTSW 13 93940598 missense probably benign 0.20
R5185:Arsb UTSW 13 93794159 missense probably damaging 1.00
R5272:Arsb UTSW 13 93794162 missense possibly damaging 0.86
R5475:Arsb UTSW 13 93862265 missense probably benign 0.00
R5580:Arsb UTSW 13 93807545 missense probably damaging 1.00
R6668:Arsb UTSW 13 93794220 critical splice donor site probably null
R7084:Arsb UTSW 13 93940616 missense probably benign 0.00
R7735:Arsb UTSW 13 93771983 missense probably benign 0.00
R7801:Arsb UTSW 13 93862327 missense probably damaging 1.00
R7859:Arsb UTSW 13 93862107 missense probably benign 0.03
X0010:Arsb UTSW 13 93794202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACTGAGGAATCGGCTTTTC -3'
(R):5'- ACTATGGTGCTGCCTGATTTACTG -3'

Sequencing Primer
(F):5'- GGAATCGGCTTTTCAGAATACGCC -3'
(R):5'- GAAATGTGTGCATGTCCATTACCG -3'
Posted On2018-04-27