Incidental Mutation 'R6371:Olfr285'
List |< first << previous [record 33 of 50] next >> last >|
ID513540
Institutional Source Beutler Lab
Gene Symbol Olfr285
Ensembl Gene ENSMUSG00000062037
Gene Nameolfactory receptor 285
SynonymsMOR160-3, GA_x6K02T2NBG7-5440777-5441736
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98309203-98317353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98313338 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 71 (Y71H)
Ref Sequence ENSEMBL: ENSMUSP00000150788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079736] [ENSMUST00000216901]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079736
AA Change: Y71H

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078672
Gene: ENSMUSG00000062037
AA Change: Y71H

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 9.3e-47 PFAM
Pfam:7tm_1 39 286 5.9e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216901
AA Change: Y71H

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Olfr285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01986:Olfr285 APN 15 98312779 missense probably damaging 0.99
IGL02658:Olfr285 APN 15 98313356 missense probably damaging 1.00
R1423:Olfr285 UTSW 15 98313443 missense probably damaging 0.99
R1442:Olfr285 UTSW 15 98313187 missense probably damaging 0.98
R1863:Olfr285 UTSW 15 98313491 missense probably benign 0.02
R1938:Olfr285 UTSW 15 98313380 missense probably damaging 1.00
R4815:Olfr285 UTSW 15 98312680 missense probably damaging 1.00
R5248:Olfr285 UTSW 15 98313430 missense probably damaging 1.00
R5879:Olfr285 UTSW 15 98313488 missense probably benign 0.00
R6000:Olfr285 UTSW 15 98313436 missense probably benign 0.08
R7466:Olfr285 UTSW 15 98313380 missense probably damaging 1.00
R7708:Olfr285 UTSW 15 98313148 missense probably damaging 1.00
R8261:Olfr285 UTSW 15 98312665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCGTTCATCATCTGACC -3'
(R):5'- GAACTTCAGTGTCGTCTCTGAG -3'

Sequencing Primer
(F):5'- CAGTCGTTCATCATCTGACCATAGAG -3'
(R):5'- AGTGTCGTCTCTGAGTTCATC -3'
Posted On2018-04-27