Incidental Mutation 'R6371:Yeats2'
ID513541
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene NameYEATS domain containing 2
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20141063-20232573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20221710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1127 (E1127G)
Ref Sequence ENSEMBL: ENSMUSP00000155892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000232019] [ENSMUST00000232338]
Predicted Effect probably benign
Transcript: ENSMUST00000090052
AA Change: E1112G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: E1112G

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115560
AA Change: E1165G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: E1165G

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232019
AA Change: E1127G

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000232338
Predicted Effect probably benign
Transcript: ENSMUST00000232613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232671
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Ifnar2 T C 16: 91,388,098 Y24H possibly damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0194:Yeats2 UTSW 16 20152969 start codon destroyed probably null 1.00
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2076:Yeats2 UTSW 16 20186282 missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4811:Yeats2 UTSW 16 20152895 splice site probably null
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5328:Yeats2 UTSW 16 20171205 missense probably damaging 1.00
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6168:Yeats2 UTSW 16 20179558 missense probably benign 0.01
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
R8353:Yeats2 UTSW 16 20222887 nonsense probably null
R8367:Yeats2 UTSW 16 20222825 missense probably damaging 1.00
R8453:Yeats2 UTSW 16 20222887 nonsense probably null
R8506:Yeats2 UTSW 16 20152934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTACTTCCACATGGCATGCAG -3'
(R):5'- AAAGTTTCTGACTGAGCAATGG -3'

Sequencing Primer
(F):5'- TGGCATGCAGAAACCCTC -3'
(R):5'- CTGACTGAGCAATGGTCTACC -3'
Posted On2018-04-27