Incidental Mutation 'R6371:Ifnar2'
List |< first << previous [record 22 of 50] next >> last >|
ID513543
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Nameinterferon (alpha and beta) receptor 2
SynonymsIfnar-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6371 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91372783-91405589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91388098 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 24 (Y24H)
Ref Sequence ENSEMBL: ENSMUSP00000134796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000117836] [ENSMUST00000134491] [ENSMUST00000139503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023693
AA Change: Y126H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: Y126H

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089042
AA Change: Y126H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971
AA Change: Y126H

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117836
AA Change: Y126H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113358
Gene: ENSMUSG00000022971
AA Change: Y126H

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134491
AA Change: Y24H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134796
Gene: ENSMUSG00000022971
AA Change: Y24H

DomainStartEndE-ValueType
Pfam:Interfer-bind 30 117 3.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139503
AA Change: Y24H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000160764
SMART Domains Protein: ENSMUSP00000123997
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
FN3 2 92 5.1e1 SMART
FN3 110 187 9.09e0 SMART
FN3 201 291 1.39e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161517
SMART Domains Protein: ENSMUSP00000125579
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
Pfam:Interfer-bind 1 100 7.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,490,274 S237L probably damaging Het
Ank3 T G 10: 69,808,879 L58V probably damaging Het
Arsb A T 13: 93,790,066 I115F possibly damaging Het
Atad2b T C 12: 4,973,970 Y32H probably damaging Het
Brd1 A C 15: 88,713,998 M515R probably benign Het
Cbx7 A G 15: 79,918,822 S30P possibly damaging Het
Cdk12 A G 11: 98,245,288 T1123A unknown Het
Cep170b A G 12: 112,740,945 D375G probably damaging Het
Clcn3 T C 8: 60,937,335 K164E probably benign Het
Clip4 A C 17: 71,856,464 K677T probably damaging Het
Clrn2 T C 5: 45,460,198 I137T possibly damaging Het
Cntln T C 4: 84,884,579 S39P probably damaging Het
Crocc2 T A 1: 93,215,631 N1318K probably benign Het
Emc1 C T 4: 139,371,665 Q820* probably null Het
Fam71e2 A G 7: 4,759,359 V257A probably benign Het
Fbxl2 G A 9: 113,989,383 T170I probably damaging Het
Fyb2 A G 4: 104,995,778 T552A probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hspg2 T C 4: 137,541,695 Y2213H probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Itgb2 C A 10: 77,548,597 P184H probably damaging Het
Kcnb2 T A 1: 15,711,212 D769E probably benign Het
Lrp1b A G 2: 40,851,654 M3087T possibly damaging Het
Ltbp3 A G 19: 5,745,772 probably null Het
Ms4a6b A G 19: 11,520,364 E9G probably damaging Het
Nat3 G A 8: 67,524,179 probably null Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nop58 T G 1: 59,711,312 probably benign Het
Olfr122 A G 17: 37,772,435 T261A probably benign Het
Olfr285 A G 15: 98,313,338 Y71H possibly damaging Het
P3h4 C T 11: 100,411,749 E354K probably benign Het
Plekhm2 T G 4: 141,629,532 T787P possibly damaging Het
Ppia C T 11: 6,418,230 T37I probably benign Het
Reln T A 5: 21,995,513 M1330L probably benign Het
Ric1 A G 19: 29,562,026 E53G probably benign Het
Sgip1 T A 4: 102,966,285 V721E probably damaging Het
Slc33a1 A T 3: 63,943,288 D538E probably benign Het
Son T C 16: 91,674,741 Het
Srebf1 A T 11: 60,203,515 S591R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Taok2 G A 7: 126,870,147 R1170W probably damaging Het
Tsc2 A T 17: 24,626,714 V210E probably benign Het
Ttc6 T A 12: 57,728,463 N1648K possibly damaging Het
Vgll3 C T 16: 65,839,245 P94L probably damaging Het
Vmn2r54 A T 7: 12,615,435 V740E probably damaging Het
Yeats2 A G 16: 20,221,710 E1127G possibly damaging Het
Zfp709 T A 8: 71,889,485 Y252N probably damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91404229 missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91404170 missense probably benign 0.33
R3078:Ifnar2 UTSW 16 91386001 missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
R7530:Ifnar2 UTSW 16 91404313 missense probably benign 0.18
R7763:Ifnar2 UTSW 16 91399293 missense probably benign 0.02
R8444:Ifnar2 UTSW 16 91403969 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCACCACACGCATGTTCGTC -3'
(R):5'- TGCCTTATACACGTGCCGAAC -3'

Sequencing Primer
(F):5'- ACACGCATGTTCGTCTTTCC -3'
(R):5'- GTGCCGAACAAAAACCTGAG -3'
Posted On2018-04-27